Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

GLP-1 analogue-Fc fusion protein and preparation method and application thereof

A GLP-1 and fusion protein technology, applied in the biological field, can solve problems such as short half-life, achieve the effects of alleviating pain, improving affinity, and reducing the frequency of injections

Active Publication Date: 2019-08-27
SHANGHAI CHEMO WANBANG BIOPHARMA
View PDF9 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, in the research, people also found that natural GLP-1 has limitations, that is, its half-life is particularly short, and it will be degraded by dipeptidyl peptidase (DPP-IV) after 2-3 minutes of secretion, even if GLP is given exogenously -1, also quickly degraded by DPP-VI

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GLP-1 analogue-Fc fusion protein and preparation method and application thereof
  • GLP-1 analogue-Fc fusion protein and preparation method and application thereof
  • GLP-1 analogue-Fc fusion protein and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Embodiment 1 Construction of recombinant fusion protein expression vector

[0089] Using gene synthesis technology, the sequences of GLP-1 analogs, Fc, and connecting peptides are translated into DNA sequences according to the codon preference of animal cells for full sequence synthesis.

[0090] The nucleotide coding sequence of the GLP-1 analog is shown in SEQ ID NO.21, specifically:

[0091] CATGGCGAGGGCACCTTCACCTCCGACGTGTCTCTCCTATCTGGAGGAGCAGGCCGCCAAGGAGTTCATCGCCTGGCTGGTGAAGGGCGGCGGC.

[0092] 1. The nucleotide coding sequence of the GLP-1 analogue is fused with the nucleotide coding sequence of the connecting peptide and the nucleotide coding sequence of IgG-Fc to obtain the nucleoside of the GLP-1 analogue-IgG-Fc fusion protein Acid coding sequence:

[0093] Specifically, wherein, the nucleotide coding sequence of the connecting peptide is shown in SEQ ID NO.22, specifically:

[0094] GGTGGTGGTGGCTCCGGAGGCGGCGGCTCT.

[0095] The nucleotide coding sequence of I...

Embodiment 2

[0131] Embodiment 2 Expression and purification of recombinant fusion protein

[0132] 1. CHO expression of recombinant fusion protein

[0133] The recombinant fusion protein expression plasmids constructed in Example 1 were respectively transfected into CHO-S cells. In order to establish CHO-S cells stably expressing each recombinant fusion protein, a 6-well cell culture plate (2.5×10 5 cells / well) were transfected with 4 μg of linearized expression plasmids for each recombinant fusion protein. After 24 hours of transfection, the cells were divided and cultured in DMEM medium containing G418 (500 μg / ml) to select those cells that had stably integrated the recombinant fusion protein expression plasmid into their genome. During the culture process, the culture medium was changed every 3 days until cell clones formed. Isolate monoclonal cells and expand into stable cell lines, and use the human GLP1 analogue kit to detect fusion proteins from the tissue culture supernatants o...

Embodiment 3

[0151] Example 3 Biological Activity and Pharmacokinetics of Recombinant Fusion Protein

[0152] 1. Research on biological activity of recombinant fusion protein

[0153] When the GLP-1R receptor protein expressed by recombinant genetically engineered GLP-1R / HEK293 cells has physiological activity, when it is stimulated by the agonist GLP-1 or its functional analogues, the physiological metabolic activities of GLP-1R / HEK293 cells Enhanced, manifested as an increase in intracellular cAMP content. Therefore, whether the GLP-1R receptor protein expressed by GLP-1R / HEK293 cells has physiological activity can be determined by measuring the change of cAMP content in GLP-1R / HEK293 cells after being stimulated by agonists such as GLP-1. The specific method is as follows: GLP-1R / HEK293 cells were cultured in a 96-well culture plate at 100 μL / well (30,000 cells / well) in DMEM medium at 37°C, 5% CO 2 Conditioned for 24 hours. The next day, the complete medium was removed, and the basal...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and specifically relates to GLP-1 analogue-Fc fusion protein and a preparation method and application thereof. The GLP-1 analogue-Fc fusion protein structurally comprises a GLP-1 analogue and an antibody Fc fragment. The GLP-1 analogue-Fc fusion protein involved in the invention effectively increases an in vivo circulation half-life period of the GLP-1 analogue, enhances in vivo and in vitro activity and stability of the GLP-1 analogue, improves affinity with FcRn, enhances penetrability and transcellular action of an in vivo tissue system of the GLP-1 analogue, improves drug effects, reduces drug injection frequency, relieves pain of patients and reduces treating cost.

Description

[0001] This application is a divisional application of the original application. The filing date of the original application is: 2016-09-29; the application number is: 2016108645530; the name of the invention is: GLP-1 analogue-Fc fusion protein and its preparation method and use. technical field [0002] The invention belongs to the field of biotechnology, and in particular relates to a GLP-1 analogue-Fc fusion protein and its preparation method and application. Background technique [0003] Cellular levels of glucagon-like peptide-1 (GLP-1) have been studied, and it was found that when glucose levels are low, GLP-1 binding to receptors causes only a small influx of calcium ions and insulin secretion, When the glucose level is high, the ATP / ADP ratio increases, and the opening time of the ATP-dependent calcium ion channel is prolonged, which can cause a large amount of calcium ion influx and insulin secretion, and the resulting physiological effects are as follows: [0004]...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62A61K38/26A61K47/68A61P3/10
CPCC07K14/605A61K38/00C07K2319/30A61P3/10
Inventor 张海涛周永春厉颖张亚楠
Owner SHANGHAI CHEMO WANBANG BIOPHARMA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com