Composition for base editing for animal embryo and base editing method

A technology of base editing and composition, applied in the field of base editing composition

Pending Publication Date: 2019-10-01
INST FOR BASIC SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Thus, indels at nuclease-targeted sites occur more frequently than single-nucleotide substitutions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition for base editing for animal embryo and base editing method
  • Composition for base editing for animal embryo and base editing method
  • Composition for base editing for animal embryo and base editing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0153] Example 1: Preparation of BE3 mRNA

[0154] By downloading pCMV-BE3 (Addgene; Catalog #73021; Image 6 ) was digested and separated, rAPOBEC1-XTEN (linker) and UGI (uracil DNA glycosylase inhibitor) were inserted into the pET-nCas9(D10A)-NLS vector (see Cho, S.W. et al. Analysis of off-target effects of CRISPR / Cas-derived RNA-guidedendonucleases and nickases.Genome Res 24,132-141 (2014)) to construct pET-Hisx6-rAPOBEC1-XTEN-nCas9-UGI-NLS (SEQ ID NO:7; Figure 7 ) Then, it was used as BE3 mRNA template.

[0155] The sequence of each region in pET-Hisx6-rAPOBEC1-XTEN-nCas9-UGI-NLS (SEQ ID NO: 7) is summarized as follows:

[0156] His x6: SEQ ID NO: 8;

[0157] rAPOBEC1: SEQ ID NO: 9;

[0158] XTEN (linker): SEQ ID NO: 10;

[0159] nCas9(D10A): SEQ ID NO: 11;

[0160]Linker: TCTGGTGGTTCT (SEQ ID NO: 14)

[0161] UGI: SEQ ID NO: 12;

[0162] Linker: TCTGGTGGTTCT (SEQ ID NO: 14)

[0163] NLS: SEQ ID NO: 13.

[0164] In the presence of primers (F: 5'-GGT GAT GTC GG...

Embodiment 2

[0165] Embodiment 2: Preparation of sgRNA

[0166] The guide RNA (sgRNA) of the targeting dystrophin gene Dmd and tyrosinase gene Tyr with the following nucleotide sequences was synthesized and used for follow-up experiments:

[0167] 5'-(target sequence)-(GUUUUAGAGCUA; SEQ ID NO:1)-(nucleotide linker)-(UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGCACCGAGUCGGUGC; SEQ ID NO:3)-3'

[0168] (except that "T" is converted to "U", the target sequence is the same as Figure 1a (Dmd) or Figure 2a The underlined nucleotide sequences in (Tyr) are identical in sequence, and

[0169] The nucleotide linker has the nucleotide sequence of GAAA).

[0170] sgRNAs were constructed by in vitro transcription using T7 RNA polymerase (see Cho, S.W., Kim, S., Kim, J.M. & Kim, J.S. Targeted genome engineering in human cells with the Cas9RNA-guidedendonuclease. Nat Biotechnol 31, 230-232 (2013)).

Embodiment 3

[0171] Embodiment 3: the preparation of ribonucleoprotein (RNP)

[0172] Transform Rosetta Competent Cells (EMD Millipore) with the pET28-Hisx6-rAPOBEC1-XTEN-nCas9(D10A)-UGI-NLS(BE3) expression vector prepared in Reference Example 1, and then use 0.5mM isopropyl β-D- 1 Thiogalactopyranoside (IPTG) was incubated at 18°C ​​for 12 to 14 hours to induce expression. After protein expression, the bacterial cells were harvested by centrifugation and passed through the lysis buffer [50mM NaH 2 PO 4 (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1% TritonX-100, 1 mM PMSF, 1 mM DTT, and 1 mg / ml lysozyme] to lyse the cell pellet.

[0173] The cell lysate thus obtained was centrifuged at 5251 xg for 30 minutes to remove cell debris. Soluble lysates were incubated with Ni-NTA beads (Qiagen) for 1 hour at 4°C. Subsequently, wash buffer [50mM NaH 2 PO 4 (pH 8.0), 300mM NaCl and 20mM imidazole] to wash the Ni-NTA beads three times, and then wash them with elution buffer [50mM Tris-HCl (pH7.6),...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided are a base editing composition comprising deaminase and target-specific nuclease, a base editing method using the base editing composition, and a method for producing a genetically modified animal. The base editing composition has a base editing activity in mammal embryos.

Description

technical field [0001] The present invention provides a base editing composition comprising a deaminase and a target-specific nuclease, a base editing method using the base editing composition, and a method for constructing a genetically modified animal. Background technique [0002] Most human genetic diseases are caused by single base substitutions or point mutations, rather than a few insertions / deletions (indels) in the genome or widespread chromosomal rearrangements. Genome editing mediated by programmable nucleases, such as clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 or Cpf1 systems, enables genetic correction of genetic defects that cause There were technical difficulties with base substitutions. This is because most DNA double-strand breaks (DSBs) generated by programmable nucleases are repaired by error-prone non-homologous end joining (NHEJ) rather than homologous recombination (HR) using template donor DNA. Thus, indels at nuclease-tar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/10C12N15/85C12N15/877C12N9/16C12N9/78C12N9/02C07K14/47
CPCC12N9/78C12N2310/20C12N15/102C12N15/90A01K2217/075A01K2227/105A01K2267/03C12N9/22C12N9/2497C12Y302/02027C07K14/4707C12N9/0071C12Y114/18001C07K2319/00C07K2319/09C07K2319/21C12N15/8509C12N15/8775C12N9/16C07K14/4708C12Y305/04005C12N15/11C12N15/85C12N15/877
Inventor金晋秀金敬美柳锡玟
OwnerINST FOR BASIC SCI