Recombinant plasmid, recombinant engineering bacterium and application thereof
A technology of recombinant engineering bacteria and recombinant plasmids, applied in recombinant DNA technology, bacteria, fungi, etc., can solve problems such as lack of specificity, and achieve the effects of enhancing efficacy, promoting uptake rate, and improving productivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] A recombinant plasmid PC20-IFN-γ-TAT, the recombinant plasmid is entrusted to Suzhou Synbio Biotechnology Co., Ltd. to synthesize and construct, which can be carried out by the following method:
[0022] (1) Synthesize the DNA sequence shown in SEQ ID No: 1, and add the coding gene of TAT(49-57) membrane-penetrating peptide: CGTAAGAAGCGTCGACAACGCCGACGT to its C-terminal (end) to form a new enhanced fragment;
[0023] (2) Cut out the cDNA fragment encoding human γ-interferon (IFN-γ) from the plasmid pBV220-γ with EcoRI;
[0024] (3) Carrying out the connection of the two fragments of steps (1) and (2) under the action of T4DNA ligase;
[0025] (4) Insert the ligated fragment into the plasmid vector PC20 to obtain the recombinant plasmid PC20-IFN-γ-TAT and verify its accuracy.
[0026] The recombinant plasmid PC20-IFN-γ containing the enhancer-like sequence but not the gene encoding the penetrating peptide was prepared in the same way.
[0027] The construction structur...
Embodiment 2
[0029] A recombinant plasmid PV20-IFN-γ-TAT, the recombinant plasmid is entrusted to Suzhou Synbio Biotechnology Co., Ltd. to synthesize and construct, which can be carried out by the following method:
[0030] (1) Synthesize the DNA sequence shown in SEQ ID No: 3, and add the coding gene of TAT(49-57) membrane-penetrating peptide: CGTAAGAAGCGTCGACAACGCCGACGT to its C-terminal (end) to form a new enhanced fragment;
[0031] (2) Cut out the cDNA fragment encoding human γ-interferon (IFN-γ) from the plasmid pBV220-γ with EcoRI;
[0032] (3) Carrying out the connection of the two fragments of steps (1) and (2) under the action of T4DNA ligase;
[0033] (4) Insert the ligated fragment into the plasmid vector PV20 to obtain the recombinant plasmid PV20-IFN-γ-TAT and verify its accuracy.
[0034] The recombinant plasmid PV20-IFN-γ containing the enhancer-like sequence but not the gene encoding the penetrating peptide was prepared in the same way.
Embodiment 3
[0036] Verification experiment of anti-tumor effect of recombinant plasmid
[0037] The experimental steps are as follows:
[0038] 1. Collect the breast cancer cells MCF-7 in the logarithmic phase, adjust the concentration of the cell suspension, and plate to make the density of the cells to be tested reach 1000 / well. The final volume of the cell suspension in each well is 100 μL (96-well flat-bottom plate). The zero-adjustment well, the control well and the three groups of drug-dosing wells are all triplicate wells. Only the culture medium was added to the zero well, and no cells were added. Cells and culture medium were added to control wells and drug-dosed wells. Lay out three boards.
[0039] 2. On the next day, replace the medium in the zero well and the control well, and add 10 μg / mL of the control plasmid pBV220-IFN-γ prepared in the medium, the recombinant plasmid that does not carry the gene encoding the penetrating peptide and the three groups of drug-dosing well...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More