Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific PAX8 regulatory factor

A technology of regulatory factors and transcription factors, which is applied in the direction of inorganic active ingredients, organic active ingredients, decapeptide ingredients, etc., can solve the problems that hinder therapeutic drugs, molecular biological basis and pharmacological effects are not particularly clear, and hinder the application of PAX8 ovarian cancer and other issues to achieve the effect of accelerating the process

Inactive Publication Date: 2019-11-26
SHANGHAI INST OF ONCOLOGY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although PAX8 has been identified as the driving oncogene of ovarian cancer in the prior art, its molecular biological basis and pharmacological effects are not particularly clear, which hinders the further application of PAX8 as a therapeutic target for ovarian cancer. In translational research, there is still a lack of effective drugs targeting PAX8, which hinders the real development of therapeutic drugs targeting this target

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific PAX8 regulatory factor
  • Specific PAX8 regulatory factor
  • Specific PAX8 regulatory factor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1 Discovery of Lineage Specificity of PAX8 Regulators in Ovarian Cancer Using COPA

[0077] Using outlier expression profiling (COPA) using microarray data, some new oncogenic driver genes were identified, and these genes were significantly overexpressed in only a small fraction of tumor cases. We reasoned that emerging transcriptome sequencing data would provide unique opportunities to define additional sample-specific dependent genes. Based on the unbiased and accurate nature of transcript quantification from RNAseq data, improved expression profiling of cancer outliers was performed using transcriptome sequencing data from approximately 700 human cancer cell lines. After setting a relatively strict threshold, a list of different candidate oncogenes is obtained, and these oncogenes show abnormal expression patterns in the comparison between different samples or in the comparison between different genes in the same sample. Many well-documented oncogenes were d...

Embodiment 2

[0079] Example 2 PAX8-FGF18 signaling pathway promotes migration of tumor cells

[0080] Further experiments were conducted on the molecular mechanism of PAX8 promoting tumorigenesis of ovarian cancer. We wanted to determine whether genes in the regulon played an important role in mediating the execution of endogenous PAX8 function. For this purpose, we transfected OVTOKO cells with small interfering RNA (siRNA) targeting PAX8, and then performed microarray analysis. Gene set enrichment analysis (GSEA) found that PAX8 knockdown can inhibit cell cycle-related pathways and multiple pathways that promote tumor metastasis. To further confirm the siRNA-based experiments, we used CRISPR-Cas9 technology in four ovarian cancer cell lines (KURAMOCHI, HEY, SKOV3, and OVTOKO) with two independent single-stranded guide RNAs (sgRNAs) (sgPAX8-1F : CACCGAGCATCCGGCCTGGAGTGAT; sgPAX8-1R: AAACATCACTCCAGGCCGGATGCTC) to knock out the PAX8 gene. Consistent with the gene chip data, PAX8 knockout...

Embodiment 3

[0082] Example 3 Type I histone deacetylase inhibitor inhibits the expression of PAX8

[0083] To study the expression of PAX8 in different cell lines, KURAMOCHI cells were finally selected as the model, because KURAMOCHI cells highly express PAX8 protein, and belong to typical high-grade serous ovarian cancer, which is the most common and deadly ovarian cancer cancer. KURAMOCHI cells were treated with 180 US Food and Drug Administration (FDA)-approved or clinically relevant small molecule compounds, and then high-throughput acquisition of PAX8 and DAPI staining images. Table 1 shows the PAX8 / DAPI signal ratios obtained from the stained images for the above compounds. The top 15 drugs that significantly reduced the ratio of PAX8 / DAPI signals were selected for further analysis. The inventors have surprisingly found that the most obvious and attractive drugs are histone deacetylase (HDAC) inhibitors. Such as Figure 3A As shown, panobinostat (panobinostat) can reduce the imm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of tumor targeting therapy, in particular to a PAX8 gene regulatory factor. The PAX8 gene regulatory factor is an inhibitor for inhibiting histone deacetylase. Thus,therapeutic use of treating cancer, especially epithelial ovarian cancer by using the histone deacetylase inhibitor is provided. The regulatory factor can be used solely and can further be used in combination with anticancer drugs such as cisplatin to produce the synergistic effect on treatment of tumors.

Description

technical field [0001] The present invention relates to the field of tumor targeting therapy, in particular to a regulatory factor targeting PAX8, and the application of the regulatory factor in the treatment of cancer, especially epithelial ovarian cancer. Background technique [0002] The development of mammals proceeds in a hierarchical manner, directed from pluripotent stem cells to differentiate into lineage-specific precursor cells, and then these cells continue to proliferate, gradually generate terminal daughter cells, and finally constitute various functional organs . In this process, the specificity of cell fate and the process of proliferation under the influence of time and space are finely regulated by tissue-specific regulators in the gene expression process, and these regulators are often a small number of important master transcription factors. Accumulating evidence suggests that during neoplastic transformation, altered core regulatory pathways retain simil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61K38/15A61K31/4045A61P35/00A61K31/555A61K33/243
CPCA61K31/4045A61K31/555A61K33/24A61K38/15A61K45/00A61P35/00A61K2300/00
Inventor 庄光磊师凯旋狄文殷霞蔡梅春
Owner SHANGHAI INST OF ONCOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com