Unlock instant, AI-driven research and patent intelligence for your innovation.

Degenerate primer set for one-time human immunodeficiency virus (HIV) genotypic resistance detection and application of degenerate primer set

A technology of degenerate primers and genotypes, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of high detection cost, high detection failure rate, long detection time, etc., and achieve increased The effect of detection success rate, saving time and reducing clinical detection cost

Inactive Publication Date: 2019-12-03
THE SECOND HOSPITAL OF NANJING
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to overcome the defects of high failure rate, high detection cost and long detection time of existing HIV genotype drug resistance detection, the present invention provides a new degenerate primer set and kit for HIV genotype drug resistance detection and The detection method uses the degenerate primer set provided by the present invention to amplify the HIV protease-reverse transcription PCR enzyme-integrase coding gene at one time, which reduces the clinical detection cost, saves time, and increases the detection success rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Degenerate primer set for one-time human immunodeficiency virus (HIV) genotypic resistance detection and application of degenerate primer set
  • Degenerate primer set for one-time human immunodeficiency virus (HIV) genotypic resistance detection and application of degenerate primer set
  • Degenerate primer set for one-time human immunodeficiency virus (HIV) genotypic resistance detection and application of degenerate primer set

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0103] 1. use Viral RNAMini (Catalog No. 52906) kit was used to extract free HIV RNA from the plasma of 5 HIV-infected patients, and the viral loads in the 5 plasmas were all greater than 1000 copies.

[0104] 2. Using Takara's one-step reverse transcription kit (PrimeScript TM One Step RT-PCR KitVer.2, article number, RR055A), add upstream primer (WC-pol-F) and downstream primer (WC-pol-R) in reverse transcription PCR primer pair in degenerate primer set described in the present invention Perform reverse transcription into cDNA. details as follows:

[0105] WC-pol-F: GAGGCTAGAAGGAGAGAGATGGGTG (SEQ ID NO. 1);

[0106] WC-pol-R: CTTCCTGCCATAG R A R ATGCCTAAG (SEQ ID NO. 2);

[0107] Table 1 Reaction system of reverse transcription PCR

[0108] Reagent Dosage Final concentration PrimeScript 1 Step Enzyme Mix 2μL 2×1 Step Buffer 25 μL 1x WC-pol-F (20μM) 1μL 0.4μM WC-pol-R (100μM) 0.8μL 0.4μM* RNA template 5μL h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a degenerate primer set for one-time human immunodeficiency virus (HIV) genotypic resistance detection and application of the degenerate primer set, and relates to the technicalfield of virus detection. The degenerate primer set includes a reverse transcription PCR primer, a nest PCR amplification primer and a sequencing universal primer; the reverse transcription PCR primer includes WC-pol-F and WC-pol-R; the nest PCR amplification primer includes WC-nest-F and WC-nest-R; and the sequencing universal primer includes HBX2-3017R, HBX2-3785R and HBX2-4561R. The degenerateprimer set is applicable to genotypic resistance detection of most of HIV-1 strains prevalent in China, a gene coding region of HIV protease-everse transcriptase-integrase can be amplified at a time,compared with a conventional method, the cost is lower, the detection speed is higher, and meanwhile the success rate of detection is higher.

Description

technical field [0001] The invention relates to the technical field of virus genotype detection, in particular to a degenerate primer set for one-time detection of HIV genotype drug resistance and its application. Background technique [0002] Human Immunodeficiency Virus (HIV) attacks the human immune system and seriously threatens human life and health. The emergence of drug-resistant mutant strains of HIV not only reduces the effect of antiviral treatment and increases the number of deaths; more importantly, the prevalence of drug-resistant strains will bring serious public health problems. For this reason, detection of HIV genotypic drug resistance mutations is very necessary. The total length of the HIV-1 genome is about 9kb. It is a single-stranded antisense RNA virus. The pol region encodes protease, reverse transcriptase and integrase, ranging from 2357nt to 5095nt, and is the main region that causes drug resistance mutations. At present, several companies have mat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6848C12N15/11
CPCC12Q1/703C12Q1/6848
Inventor 陈伟胡志亮王卫晓
Owner THE SECOND HOSPITAL OF NANJING
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More