Common donor stem cell and preparation method thereof

A technology of stem cells and donors, applied in the field of stem cells, can solve the problems of iPSCs such as expensive, immune rejection, and variability

Inactive Publication Date: 2020-02-21
赛元生物科技(杭州)有限公司
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Unfortunately, iPSC generation remains an expensive, time-consuming and highly variable process in terms of pluripotency, epigenetic status, differentiation capacity and genome stability
Furthermore, changes that occur during reprogramming and prolonged culture were found to trigger adaptive immune responses leading to immune rejection of even autologous stem cell-derived grafts

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Common donor stem cell and preparation method thereof
  • Common donor stem cell and preparation method thereof
  • Common donor stem cell and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1 HLA Class I Project

[0065] Since HLA-I is a dimer composed of α chain and β chain, and all HLA-I share the same β chain, knocking out the B2M gene encoding the β chain can achieve the knockout of HLA-I; However, for some cells, HLA-I knocked out cells will be lysed by NK cells. In order to overcome this "missing self" reaction, the inventors knocked out the HLA single chain while knocking in the heavy chain of the non-polymorphic HLA-E gene to inhibit the lysis of NK cells.

[0066] 1. Design of sgRNA

[0067] 1.1 Selection of sgRNA design location

[0068] According to the gene name B2M searched in NCBI, B2M has four exons. In order to completely knock out B2M without affecting the expression of other proteins, the inventor designed sgRNA on the first exon. The search can be found in NCBI, in the UCSC database, or in geneious software. In the future, SgRNA can be designed on the transcript shared by this gene. Generally, the gene-specific sgRNA template sequenc...

Embodiment 2

[0155] Example 2 HLAⅡ Project

[0156] Unlike HLA class I, class II proteins lack common subunits that can be edited to prevent surface expression. MHC class II deficiency is a combined immunodeficiency caused by defects in the four regulatory factors CIITA, RFXANK, RFX5 and rfxp, which control the expression of MHC II at the transcriptional level. The RFXANK gene encodes a subunit of the heterotrimeric RFX complex, which is involved in the assembly of several transcription factors on the MHC II promoter. Therefore, the present invention edits two copies of the RFXANK transcription factor gene required for MHC class II expression. Patients with RFXANK mutations do not express HLA class II molecules on their antigen presenting cells. And transferred to iCaspase to enhance its safety.

[0157] The relative positions of the three sgRNAs targeting the RFXANK site are as follows Picture 10 As shown, the sequences are as follows:

[0158] GCAGAAGACCTCATCCAGAC (SEQ ID NO: 22)

[0159] T...

Embodiment 3

[0184] Example 3 Differentiation of modified embryonic stem cells

[0185] Modified embryonic stem cells can differentiate into various cell types with reduced or absent HLA expression. Examples of these cell types include mesenchymal progenitor cells (MPC), low immunogenic cardiomyocytes, endothelial cells (EC), macrophages, hepatocytes, leukocytes (e.g. pancreatic leukocytes) or neural progenitor cells (NPC).

[0186] Initially, the inventors reduced MHC-I expression in B2M- / - and B2M- / -RFXANK- / - human ES cells. The inventors then examined the expression of MHC-I in various differentiated cell types. For example, the expression of MHC-I and MHC-II decreased in B2M- / - and B2M- / -RFXANK- / - human mesenchymal progenitor cells (MPC) ( Figure 14 , Figure 15 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a common donor stem cell and a preparation method thereof. The common donor stem cell disclosed by the invention can be used for overcoming immunological rejection in a transplantation therapy based on cells, specifically, the common donor stem cell disclosed by the invention does not express MHC-I (major histocompatibility complex-I) or MHC-II (or HLA-I (human leucocyte antigen-I) or HLA-II), and thus the stem cell has low immunogenicity.

Description

Technical field [0001] The invention relates to the field of stem cells, in particular to a universal donor stem cell and a preparation method thereof. Background technique [0002] Pluripotent stem cells have great therapeutic potential. These undifferentiated cells can produce almost any specialized cell type, as a natural repair system for damaged tissues, or as new therapeutic agents that can be further designed to treat diseases. Scientists use the unique properties of stem cells to treat diseases related to dead or damaged cells. Currently, in Europe, 26,000 patients receive stem cell therapy every year to treat blood diseases and some cancers, including leukemia. However, human donors are currently the main source of stem cells, which limits the success of treatment due to rejection by the patient's immune system. At present, the latest advances in stem cell biology make it possible to consider the patient's own cells as an unlimited source of transplantation. Unfortun...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/87
CPCC12N5/0602C12N5/0606C12N5/0696C12N15/87C12N2510/00
Inventor张进
Owner赛元生物科技(杭州)有限公司