Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

32 results about "Human leucocyte antigen" patented technology

Gene panel used for detecting breast cancer gene mutation, detection method used for detecting breast cancer gene mutation and application of gene panel

The invention relates to a gene panel used for detecting breast cancer gene mutation, and a detection method and application of the gene panel. The panel disclosed by the invention comprises 54419 pieces of targeted DNA (deoxyribonucleic acid) probes. The targeted DNA comprises the exon regions of 445 pieces of genes on the human genomes, 2573 pieces of MSI (microsatellite instability) sites and 566 position intervals used for detecting gene fusion. The detection method in the invention can be used for detecting SNV (single nucleotide variation), Indel (Insertion and Deletion), CNV (Copy Number Variation), Fusion, MSI, TMB (Tumor Mutational Burden), HLA (human leucocyte antigen) parting and the like of a tumor somatic cell multi-site DNA mutation. An optimal individual treatment medicine and scheme can be conveniently selected according to the genome features of patients in a breast cancer immunotherapy process.
Owner:北斗生命科学(广州)有限公司 +1

Primers, probe, fluorescent PCR kit and method for detecting human HLA-B*1301 gene

The invention provides primers, a probe, a fluorescent PCR kit and a detection method for detecting a human HLA-B*1301 allele. According to the theory of 'allele specific PCR', a human leucocyte antigen HLA-B*1301 allele can be detected on a real-time fluorescent quantitative PCR technical platform.
Owner:SUZHOU KUANGYUAN MOLECULAR BIOTECH

HTNV-NP (Hantaan virus nucleoprotein)-specific CTL (cytotoxic T lymphocyte) epitope peptides and application thereof

The invention discloses HTNV-NP (Hantaan virus nucleoprotein)-specific CTL (cytotoxic T lymphocyte) epitope peptides and application thereof. The CTL epitope peptides have amino acid sequences shown in SEQ ID NO:1-12. Especially, HLA-I (human leucocyte antigen-I) molecule restricted epitope polypeptide in the HTNV-NP-specific CTL epitope peptides can induce CD8+T lymphocyte to generate strong cellular immune response and secrete high-level IFN-gamma. The HTNV-NP-specific CTL epitope peptides can be used for preparing CTL epitope peptide vaccines or for inducing the generation of CTL epitope peptide-specific CTL, or for preparing CTL epitope peptide-sensitized antigen presenting cells and have bright development and application prospects in the field of specific immunization therapy of HFRS (hemorrhagic fever with renal syndrome).
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Special primer and kit for detecting human leucocyte antigen-B27 (HLA-B27) gene

The invention discloses a special primer for detecting a human leucocyte antigen-B27 (HLA-B27) gene. The special primer is characterized by comprising an upstream primer B27-1, a downstream primer B27-2 and a probe B27-probe which are used for detecting target genes, and an upstream primer Gapdh-1, a downstream primer Gapdh-2 and a probe Gapdh-probe which are used for detecting an internal control gene, namely glyceraldehyde-3-phosphate dehydrogenase (GAPDH), wherein the B27-1 is shown as GGGTCTCACACCCTCCAGAAT, the B27-2 is shown as CGGCGGTCCAGGAGCT, and the B27-probe is shown as FAM-TACCACCAGGACGCCTAC-TAMRA; and the Gapdh-1 is shown as CAGGTGGAGCGAGGCTAG, the Gapdh-2 is shown as CTACCCATGACTCAGCTTCTCC, and the Gapdh-probe is shown as HEX-ACCATGCCACAGCCACCACACCTC-BHQ1. The invention also provides a kit for detecting the HLA-B27 gene. A method for detecting the gene by using one pipe replaces the original method for detecting the gene by using two pipes, the amount of samples which can be detected by a machine at a time is increased, and the detection efficiency is improved to a great extent.
Owner:FUZHOU ADICON CLINICAL LAB INC

Kit and method for detecting human leucocyte antigen HLA-B*1502 genetype

The invention discloses a kit and a method for detecting human leucocyte antigen HLA-B*1502 genetype. The kit disclosed by the invention is characterized by comprising the following primer sequences: a forward primer FP: 5'-CGACGCCGCGAGTCCCAGG-3'; and a reverse primer RP: 5'-CGTCGTAGGCGGACTGGTCATA-3'. The kit further comprises the following probe sequence: a probe PR: 5'-Cy5-AACACACAGATCTCCAAGACCAACACAC-p-3'. The kit disclosed by the invention has good specificity and sensitivity for carrying out PCR (Polymerase Chain Reaction) detection of the human leucocyte antigen HLA-B*1502. The PCR detection method disclosed by the invention has the advantages of being simple for operation (closed pipe), rapid, accurate and the like and is applied to clinical molecular diagnosis.
Owner:瀚吉康生物科技(北京)有限公司

Reagent kit for detecting HBB gene mutation and HLA genotyping

The invention provides a method for detecting HBB gene mutation and HLA genotyping based on the high throughput sequencing technology and a corresponding reagent kit. An adopted primer composition comprises a primer of closely-linked single nucleotide polymorphisms (SNP) within the 1 Mb range of the up stream and the down stream of the specific amplification human embryo beta-thalassemia HBB gene and primers of the closely-linked single nucleotide polymorphisms (SNP) within the ranges at the up stream of the LHA-A gene, between the HLA-A gene and the HLA-B gene, between the HLA-B gene and the HLA-DRA gene, between the HLA-DRA gene and the HLA-DQB1 gene and at the downstream of the HLA-DQB1 gene of the specific amplification human leucocyte antigen system. The method has the advantages of university, single nucleotide polymorphisms (SNP) sequencing, high throughput, low cost, high flexibility and strong specificity.
Owner:海南医学院附属医院 +1

Method and related kit for detecting c-MET/CEP7 gene status based on rare cells

The invention relates to a method and a related kit for detecting c-MET / CEP7 gene status based on rare cells, wherein the method comprises the following steps: 1. acquiring a blood sample or a body fluid sample, wherein the sample includes a mixed cell population of circulating tumor cells or other rare cells and white blood cells; 2. diluting the sample by virtue of a buffer solution, removing plasma and recovering CTC or other rare cells; 3. cracking by virtue of a red blood cell lysis buffer, removing red blood cells and recovering CTC or other rare cells; 4. recovering cells with magnetic particles coated with related anti-human leucocyte antigens and antibodies, uniformly mixing and breeding, and fully combining so as to form a magnetic particle-white blood cell mixture; 5. isolating the magnetic particle-white blood cell mixture from other cells so as to obtain a mixed cell population containing CTC or other rare cells and a few of white blood cells; and 6. by virtue of a method combining immunofluorescence cytochemistry and fluorescence in-situ hybridization, determining the status of c-MET / CEP7, and simultaneously identifying CTC or other rare cells.
Owner:北京莱尔生物医药科技有限公司

Preparation method and kit for dendritic cell vaccine loaded by tumor specific antigenic epitope polypeptide

The invention provides a preparation method for a dendritic cell vaccine loaded by a tumor specific antigenic epitope polypeptide. The method comprises the following steps: adopting a human leucocyte antigen A201 positive epitope of an epithelial cell adhesion molecule identified by tumor specific expression, namely a polypeptide composed of amino acid sequences represented by any one of SEQ ID NO.1-6; loading dendritic cells by using the polypeptide of any one of the SEQ ID NO.1-6 to prepare the dendritic cell vaccine. The dendritic cell vaccine can be used for initiating a very strong target anti-tumor cytotoxic T lymphocyte effect. The invention further provides a kit for preparing the dendritic cell vaccine loaded by the tumor specific antigenic epitope polypeptide.
Owner:李金珍

Preparation and use of micro-array chip for HLA-B27 genotyping

The invention relates to a gene detection kit used for clinical detection, in particular to the preparation and the usage of a micro-array chip used for HLA-B27 genotyping. A DNA micro-array chip technology is adopted, and the kit can carry out partign to human leucocyte antigen B27, with high pass, high efficiency and high specificity.
Owner:GUANGZHOU DARUI BIOTECH

Method for rapidly detecting human leucocyte antigen B27 (HLA-B27) and kit thereof

The invention relates to a method for rapidly detecting a human leucocyte antigen B27 (HLA-B27) and an in-vitro diagnosis kit, which belong to the technical field of medical biology. In the kit, a pair of HLA-B27 specific primers and a specific fluorescent probe are adopted for rapidly detecting the HLA-B27. In the kit, the pair of HLA-B27 specific primer and the specific fluorescent probe can beused for rapidly and accurately detecting HLA-B27 genes in samples such as human peripheral blood and the like, and the kit has the advantages of high specificity, high sensitivity, time saving, labor saving, low cost, high flux and the like, and can be applied to auxiliary diagnosis of multiple spondyloarthropathies which severely endanger human health such as clinical ankylosing spondylitis, Reiter syndrome, psoriatic arthritis, ulcerative colitis accompanying arthropathy, acute anterior tract uveal, and the like.
Owner:浙江夸克生物科技有限公司

Primer, probe, fluorescence PCR (Polymerase Chain Reaction) kit and method for detecting HLA (Human Leucocyte Antigen)-B*5801 genes

The invention provides a primer, a probe, a fluorescence PCR (Polymerase Chain Reaction) kit and a method for detecting HLA (Human Leucocyte Antigen)-B*5801 alleles. Human leucocyte antigen (HLA)-B*5801 alleles are detected on a real-time fluorescent quantitative PCR technical platform according to the principle of 'allele specific PCR'.
Owner:SUZHOU KUANGYUAN MOLECULAR BIOTECH

Method and related kit for detecting HER-2/CEP17 gene status based on rare cells

The invention relates to a method and a related kit for detecting HER-2 / CEP17 gene status based on rare cells, wherein the method comprises the following steps: 1. acquiring a blood sample or a body fluid sample, wherein the sample includes a mixed cell population of circulating tumor cells or other rare cells and white blood cells; 2. diluting the sample by virtue of a buffer solution, removing plasma and recovering CTC or other rare cells; 3. cracking by virtue of a red blood cell lysis buffer, removing red blood cells and recovering CTC or other rare cells; 4. uniformly mixing and breeding magnetic particles coated with related anti-human leucocyte antigens and antibodies with the recovered cells, and combining so as to form a magnetic particle-white blood cell mixture; 5. isolating the magnetic particle-white blood cell mixture from other cells so as to obtain a mixed cell population containing CTC or other rare cells and a few of white blood cells; and 6. by virtue of a method combining immunofluorescence cytochemistry and fluorescence in-situ hybridization, determining the status of HER-2 / CEP17, and simultaneously identifying CTC or other rare cells.
Owner:北京莱尔生物医药科技有限公司

Treatment of hepatitis d virus infections by redirection of t cells

Several approaches to treat, inhibit, or prevent HDV infections by redirecting T cells to HDV and HDV infected cells are described. In several alternatives, a gene encoding a molecule that specifically binds to human leucocyte antigen (HLA) loaded with a HDV derived peptide are introduced into the T cells of individuals. Upon receiving the modified T cells, the modified T cells, derived from the individual, will then recognise the individual's cells that are infected by HDV and / or the HDV virus, blocking HDV replication and / or killing the HDV infected cells thereby preventing and / or treating or inhibiting the HDV infection in the individual.
Owner:CHRONTECH PHARMA

Human leucocyte antigen genotyping method and reagent thereof

InactiveCN105296618ASolve the problem that cannot be effectively typedHigh resolutionMicrobiological testing/measurementAntigenHuman leucocyte antigen
The invention discloses a human leucocyte antigen genotyping method and a reagent thereof. The method comprises the following steps: firstly, implementing PCR amplification to HLA-B and HLA-C site genes of to-be-detected genome DNA; and then, conducting a sequencing reaction to amplification products by virtue of 12 sequencing primers so as to determine a genotype, wherein the sequencing primers include 5th, 6th and 7th sequencing primers of an HLA-B exon and 5th, 6th and 7th sequencing primers of an HLA-C exon. The method disclosed by the invention, by virtue of additionally exon sequencing in an irregular detection area, can effectively solve the problem that many and many ambiguous results appear during HLA high-resolution genotyping. The obtained sequence is free from a background signal and a miscellaneous peak; and the sequence, which can be introduced into analysis software which is matched with the commercial reagent, is easy for recognition and result interpretation. The primers disclosed by the invention can undergo synchronous amplification and sequencing with a commercial kit, so as to improve the working efficiency and to significantly reduce the cost of the reagent; therefore, the invention is of very significant meaning in the improvement of the detection efficiency.
Owner:SHENZHEN BLOOD CENT

Primers, probe, fluorescent PCR kit and method for detecting human HLA-B*27 gene

The invention provides primers, a probe, a fluorescent PCR kit and a detection method for detecting a human HLA-B*27 allele. According to the theory of 'allele specific PCR', a human leucocyte antigen HLA-B*27 allele can be detected on a real-time fluorescent quantitative PCR technical platform.
Owner:SUZHOU KUANGYUAN MOLECULAR BIOTECH

Kit and method for detecting human leucocyte antigen HLA-B*1502 genetype

The invention discloses a kit and a method for detecting human leucocyte antigen HLA-B*1502 genetype. The kit disclosed by the invention is characterized by comprising the following primer sequences: a forward primer FP: 5'-CGACGCCGCGAGTCCCAGG-3'; and a reverse primer RP: 5'-CGTCGTAGGCGGACTGGTCATA-3'. The kit further comprises the following probe sequence: a probe PR: 5'-Cy5-AACACACAGATCTCCAAGACCAACACAC-p-3'. The kit disclosed by the invention has good specificity and sensitivity for carrying out PCR (Polymerase Chain Reaction) detection of the human leucocyte antigen HLA-B*1502. The PCR detection method disclosed by the invention has the advantages of being simple for operation (closed pipe), rapid, accurate and the like and is applied to clinical molecular diagnosis.
Owner:瀚吉康生物科技(北京)有限公司

Method of determining susceptibility to prion disease

This invention relates to a method of determining the susceptibility of a subject to prion disease comprising the steps of: (a) providing a sample from said subject and in determining the human leucocyte antigen specificity of said sample, wherein if said sample has DQ7 human leucocyte antigen specificity, this indicates that said subject has a decreased susceptibility to prion disease, and if said sample does not have DQ7 human leucocyte antigen specificity, this indicates that said subject has an increased susceptibility to prion disease.
Owner:MEDICAL RESEARCH COUNCIL

Common donor stem cell and preparation method thereof

The invention discloses a common donor stem cell and a preparation method thereof. The common donor stem cell disclosed by the invention can be used for overcoming immunological rejection in a transplantation therapy based on cells, specifically, the common donor stem cell disclosed by the invention does not express MHC-I (major histocompatibility complex-I) or MHC-II (or HLA-I (human leucocyte antigen-I) or HLA-II), and thus the stem cell has low immunogenicity.
Owner:赛元生物科技(杭州)有限公司

Methods and kits for generating and selecting a variant of a binding protein with increased binding affinity and/or specificity

Somatic hypermutation promotes affinity maturation of antibodies by targeting the cytidine deaminase AID to antibody genes, followed by antigen-based selection of matured antibodies. Given the importance of antibodies in medicine and research, developing approaches to reproduce this natural phenomenon in cell culture is of some interest. The inventors use here the CRISPR-Cas 9 based CRISPR-X approach to target AID to antibody genes carried by expression vectors in HEK 293 cells. This directed mutagenesis approach, combined with a highly sensitive antigen-associated magnetic enrichment process, allowed rapid progressive evolution of a human antibody against the Human Leucocyte Antigen A*0201 allele. Starting from a low affinity monoclonal antibody expressed on Ag-specific naïve blood circulating B cells, they obtained in approximately 6 weeks antibodies with a two log increase in affinity and which retained their specificity. The strategy for in vitro affinity maturation of antibodies is applicable to virtually any antigen. It not only allows to tap into the vast naive B cell repertoire but could also be useful when dealing with antigens that only elicit low affinity antibodies after immunization. Accordingly as defined by the claims, the present invention relates to methods and kits for generating and selecting a variant of antibody binding protein with increased binding affinity and / or specificity.
Owner:UNIV DE NANTES

hbb gene mutation and hla typing detection kit

The invention provides a method for detecting HBB gene mutation and HLA genotyping based on the high throughput sequencing technology and a corresponding reagent kit. An adopted primer composition comprises a primer of closely-linked single nucleotide polymorphisms (SNP) within the 1 Mb range of the up stream and the down stream of the specific amplification human embryo beta-thalassemia HBB gene and primers of the closely-linked single nucleotide polymorphisms (SNP) within the ranges at the up stream of the LHA-A gene, between the HLA-A gene and the HLA-B gene, between the HLA-B gene and the HLA-DRA gene, between the HLA-DRA gene and the HLA-DQB1 gene and at the downstream of the HLA-DQB1 gene of the specific amplification human leucocyte antigen system. The method has the advantages of university, single nucleotide polymorphisms (SNP) sequencing, high throughput, low cost, high flexibility and strong specificity.
Owner:海南医学院附属医院 +1

Sequencing-based typing method of human leucocyte antigen (HLA)-Cw gene

The invention provides a sequencing-based typing method of human leucocyte antigen (HLA)-Cw genes, comprising the following steps: a. carrying out PCR amplification on a typing target region by two pairs of PCR amplification primers, wherein the first pair of amplification primers contains a sequence from a first exon to a fourth exon, and the second pair of amplification primers contains a sequence from a fifth exon to an eighth exon; and b. carrying out sequencing reaction on the obtained amplified product by twelve forward sequencing primers and reverse sequencing primer, wherein the first exon, the second exon, the third exon, the fourth exon and the fifth exon of the HLA-Cw genes are subject to forward and reverse sequencing respectively, the sixth exon is subject to forward sequencing and the seventh exon is subject to reverse sequencing. The invention is established based on full-length sequence of the HLA-Cw genes and single nucleotide polymorphisms (SNPs) data, solving the problems of missed detection of an allele Cw*0706 occurred in population detection via an AlleleSEQR HLA-Cw plus kit and ambiguous results occurred in sequencing-based typing. The method is applicable to high-resolution horizontal gene typing of the HLA-Cw genes in Chinese population, and is beneficial to various application and basic researches of the HLA-Cw genes.
Owner:SHENZHEN BLOOD CENT

Vaccine for Malignant Tumor Treatment

PendingUS20200129602A1Stimulate immune responsePreventing the binding of immune system-side receptorsMacromolecular librariesDisease diagnosisWhite blood cellSpecific immunity
Disclosed are methods for preparing a medicament for treating a malignant tumor, along with cell membranes prepared by such methods and the use thereof, in which the individual communication structure between the malignant tumor and the immune system is ascertained based upon a tissue sample containing cells of the malignant tumor by determining a malignant tumor-specific expression pattern of histocompatibility antigens (Human Leucocyte Antigen, HLA) on said tissue sample, masking or removing at least a part of the expression pattern present on the cells of the tissue sample that is capable of exerting an inhibitory effect on immunocompetent cells, and preparing an individual vaccine for eliciting a specific immunological response by lysing those cells on which a part of the expression pattern has been masked or removed.
Owner:INTELLEXON GMBH

Methods and delivery of allogeneic cell products

The present invention relates to methods for selecting at least one drug product from a cell bank that recognizes a combination of at least one specific disease-associated antigenic peptide with at least one unique human leucocyte antigen (HLA) molecule which closely matches the HLA allele-specific expression profile of a subject. The invention also provides methods for treating a diseased cell expressing at least one disease-associated antigen which comprises the determination of the HLA allele-specific expression profile of the disease cell and the , and the selection and administration of at least one drug product. The invention also relates to a cell bank comprising a plurality of disease-associated antigen-specific T cell subpopulations, each subpopulation of T cells being primed by a plurality of subpopulations of antigen presenting cells (APCs), each subpopulation of APCs being genetically modified to express a unique HLA molecule which presents a specific disease-associated antigenic peptide.
Owner:MANA THERAPEUTICS

HLA-B27 genotyping detection kit

The invention relates to a gene detection kit used for clinical detection, in particular to the preparation and the usage of a micro-array chip used for HLA-B27 genotyping. A DNA micro-array chip technology is adopted, and the kit can carry out partign to human leucocyte antigen B27, with high pass, high efficiency and high specificity.
Owner:GUANGZHOU DARUI BIOTECH

Drug response markers

InactiveUS20110105538A1Powerful predictorBiocideNervous disorderHuman leucocyte antigenDisease
The present invention relates to a method for predicting the response of a disease in a subject, preferably a human, to a drug providing 6-mercaptopurine, the method comprising the step of: (i) determining the presence or absence of a variant allele at a polymorphic site in a human leucocyte antigen (HLA)-G gene wherein the presence of said variant allele at said polymorphic site is indicative of clinical response or tolerance to said drug. The invention also provides a method of treating a subject suffering from a condition that would benefit from a drug providing 6-mercaptopurine.
Owner:GUYS & ST THOMASS NHS FOUND TRUST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products