32 results about "Human leucocyte antigen" patented technology

The invention provides primers, a probe, a fluorescent PCR kit and a detection method for detecting a human HLA-B*1301 allele. According to the theory of 'allele specific PCR', a human leucocyte antigen HLA-B*1301 allele can be detected on a real-time fluorescent quantitative PCR technical platform.

The invention discloses HTNV-NP (Hantaan virus nucleoprotein)-specific CTL (cytotoxic T lymphocyte) epitope peptides and application thereof. The CTL epitope peptides have amino acid sequences shown in SEQ ID NO:1-12. Especially, HLA-I (human leucocyte antigen-I) molecule restricted epitope polypeptide in the HTNV-NP-specific CTL epitope peptides can induce CD8+T lymphocyte to generate strong cellular immune response and secrete high-level IFN-gamma. The HTNV-NP-specific CTL epitope peptides can be used for preparing CTL epitope peptide vaccines or for inducing the generation of CTL epitope peptide-specific CTL, or for preparing CTL epitope peptide-sensitized antigen presenting cells and have bright development and application prospects in the field of specific immunization therapy of HFRS (hemorrhagic fever with renal syndrome).

The invention discloses a special primer for detecting a human leucocyte antigen-B27 (HLA-B27) gene. The special primer is characterized by comprising an upstream primer B27-1, a downstream primer B27-2 and a probe B27-probe which are used for detecting target genes, and an upstream primer Gapdh-1, a downstream primer Gapdh-2 and a probe Gapdh-probe which are used for detecting an internal control gene, namely glyceraldehyde-3-phosphate dehydrogenase (GAPDH), wherein the B27-1 is shown as GGGTCTCACACCCTCCAGAAT, the B27-2 is shown as CGGCGGTCCAGGAGCT, and the B27-probe is shown as FAM-TACCACCAGGACGCCTAC-TAMRA; and the Gapdh-1 is shown as CAGGTGGAGCGAGGCTAG, the Gapdh-2 is shown as CTACCCATGACTCAGCTTCTCC, and the Gapdh-probe is shown as HEX-ACCATGCCACAGCCACCACACCTC-BHQ1. The invention also provides a kit for detecting the HLA-B27 gene. A method for detecting the gene by using one pipe replaces the original method for detecting the gene by using two pipes, the amount of samples which can be detected by a machine at a time is increased, and the detection efficiency is improved to a great extent.

The invention discloses a kit and a method for detecting human leucocyte antigen HLA-B*1502 genetype. The kit disclosed by the invention is characterized by comprising the following primer sequences: a forward primer FP: 5'-CGACGCCGCGAGTCCCAGG-3'; and a reverse primer RP: 5'-CGTCGTAGGCGGACTGGTCATA-3'. The kit further comprises the following probe sequence: a probe PR: 5'-Cy5-AACACACAGATCTCCAAGACCAACACAC-p-3'. The kit disclosed by the invention has good specificity and sensitivity for carrying out PCR (Polymerase Chain Reaction) detection of the human leucocyte antigen HLA-B*1502. The PCR detection method disclosed by the invention has the advantages of being simple for operation (closed pipe), rapid, accurate and the like and is applied to clinical molecular diagnosis.

The invention provides a method for detecting HBB gene mutation and HLA genotyping based on the high throughput sequencing technology and a corresponding reagent kit. An adopted primer composition comprises a primer of closely-linked single nucleotide polymorphisms (SNP) within the 1 Mb range of the up stream and the down stream of the specific amplification human embryo beta-thalassemia HBB gene and primers of the closely-linked single nucleotide polymorphisms (SNP) within the ranges at the up stream of the LHA-A gene, between the HLA-A gene and the HLA-B gene, between the HLA-B gene and the HLA-DRA gene, between the HLA-DRA gene and the HLA-DQB1 gene and at the downstream of the HLA-DQB1 gene of the specific amplification human leucocyte antigen system. The method has the advantages of university, single nucleotide polymorphisms (SNP) sequencing, high throughput, low cost, high flexibility and strong specificity.

The invention relates to a method and a related kit for detecting c-MET/CEP7 gene status based on rare cells, wherein the method comprises the following steps: 1. acquiring a blood sample or a body fluid sample, wherein the sample includes a mixed cell population of circulating tumor cells or other rare cells and white blood cells; 2. diluting the sample by virtue of a buffer solution, removing plasma and recovering CTC or other rare cells; 3. cracking by virtue of a red blood cell lysis buffer, removing red blood cells and recovering CTC or other rare cells; 4. recovering cells with magnetic particles coated with related anti-human leucocyte antigens and antibodies, uniformly mixing and breeding, and fully combining so as to form a magnetic particle-white blood cell mixture; 5. isolating the magnetic particle-white blood cell mixture from other cells so as to obtain a mixed cell population containing CTC or other rare cells and a few of white blood cells; and 6. by virtue of a method combining immunofluorescence cytochemistry and fluorescence in-situ hybridization, determining the status of c-MET/CEP7, and simultaneously identifying CTC or other rare cells.

The invention provides a preparation method for a dendritic cell vaccine loaded by a tumor specific antigenic epitope polypeptide. The method comprises the following steps: adopting a human leucocyte antigen A201 positive epitope of an epithelial cell adhesion molecule identified by tumor specific expression, namely a polypeptide composed of amino acid sequences represented by any one of SEQ ID NO.1-6; loading dendritic cells by using the polypeptide of any one of the SEQ ID NO.1-6 to prepare the dendritic cell vaccine. The dendritic cell vaccine can be used for initiating a very strong target anti-tumor cytotoxic T lymphocyte effect. The invention further provides a kit for preparing the dendritic cell vaccine loaded by the tumor specific antigenic epitope polypeptide.

The invention relates to a gene detection kit used for clinical detection, in particular to the preparation and the usage of a micro-array chip used for HLA-B27 genotyping. A DNA micro-array chip technology is adopted, and the kit can carry out partign to human leucocyte antigen B27, with high pass, high efficiency and high specificity.

The invention relates to a method and a related kit for detecting HER-2/CEP17 gene status based on rare cells, wherein the method comprises the following steps: 1. acquiring a blood sample or a body fluid sample, wherein the sample includes a mixed cell population of circulating tumor cells or other rare cells and white blood cells; 2. diluting the sample by virtue of a buffer solution, removing plasma and recovering CTC or other rare cells; 3. cracking by virtue of a red blood cell lysis buffer, removing red blood cells and recovering CTC or other rare cells; 4. uniformly mixing and breeding magnetic particles coated with related anti-human leucocyte antigens and antibodies with the recovered cells, and combining so as to form a magnetic particle-white blood cell mixture; 5. isolating the magnetic particle-white blood cell mixture from other cells so as to obtain a mixed cell population containing CTC or other rare cells and a few of white blood cells; and 6. by virtue of a method combining immunofluorescence cytochemistry and fluorescence in-situ hybridization, determining the status of HER-2/CEP17, and simultaneously identifying CTC or other rare cells.

Several approaches to treat, inhibit, or prevent HDV infections by redirecting T cells to HDV and HDV infected cells are described. In several alternatives, a gene encoding a molecule that specifically binds to human leucocyte antigen (HLA) loaded with a HDV derived peptide are introduced into the T cells of individuals. Upon receiving the modified T cells, the modified T cells, derived from the individual, will then recognise the individual's cells that are infected by HDV and/or the HDV virus, blocking HDV replication and/or killing the HDV infected cells thereby preventing and/or treating or inhibiting the HDV infection in the individual.

The invention provides primers, a probe, a fluorescent PCR kit and a detection method for detecting a human HLA-B*27 allele. According to the theory of 'allele specific PCR', a human leucocyte antigen HLA-B*27 allele can be detected on a real-time fluorescent quantitative PCR technical platform.

The present invention discloses an antagonist of human leukocyte antigen DR4 subtype protein. Said invention also provides its chemical structure formula and its concrete application range.

The invention discloses a common donor stem cell and a preparation method thereof. The common donor stem cell disclosed by the invention can be used for overcoming immunological rejection in a transplantation therapy based on cells, specifically, the common donor stem cell disclosed by the invention does not express MHC-I (major histocompatibility complex-I) or MHC-II (or HLA-I (human leucocyte antigen-I) or HLA-II), and thus the stem cell has low immunogenicity.

Somatic hypermutation promotes affinity maturation of antibodies by targeting the cytidine deaminase AID to antibody genes, followed by antigen-based selection of matured antibodies. Given the importance of antibodies in medicine and research, developing approaches to reproduce this natural phenomenon in cell culture is of some interest. The inventors use here the CRISPR-Cas 9 based CRISPR-X approach to target AID to antibody genes carried by expression vectors in HEK 293 cells. This directed mutagenesis approach, combined with a highly sensitive antigen-associated magnetic enrichment process, allowed rapid progressive evolution of a human antibody against the Human Leucocyte Antigen A*0201 allele. Starting from a low affinity monoclonal antibody expressed on Ag-specific naïve blood circulating B cells, they obtained in approximately 6 weeks antibodies with a two log increase in affinity and which retained their specificity. The strategy for in vitro affinity maturation of antibodies is applicable to virtually any antigen. It not only allows to tap into the vast naive B cell repertoire but could also be useful when dealing with antigens that only elicit low affinity antibodies after immunization. Accordingly as defined by the claims, the present invention relates to methods and kits for generating and selecting a variant of antibody binding protein with increased binding affinity and/or specificity.

Disclosed are methods for preparing a medicament for treating a malignant tumor, along with cell membranes prepared by such methods and the use thereof, in which the individual communication structure between the malignant tumor and the immune system is ascertained based upon a tissue sample containing cells of the malignant tumor by determining a malignant tumor-specific expression pattern of histocompatibility antigens (Human Leucocyte Antigen, HLA) on said tissue sample, masking or removing at least a part of the expression pattern present on the cells of the tissue sample that is capable of exerting an inhibitory effect on immunocompetent cells, and preparing an individual vaccine for eliciting a specific immunological response by lysing those cells on which a part of the expression pattern has been masked or removed.

The present invention relates to methods for selecting at least one drug product from a cell bank that recognizes a combination of at least one specific disease-associated antigenic peptide with at least one unique human leucocyte antigen (HLA) molecule which closely matches the HLA allele-specific expression profile of a subject. The invention also provides methods for treating a diseased cell expressing at least one disease-associated antigen which comprises the determination of the HLA allele-specific expression profile of the disease cell and the , and the selection and administration of at least one drug product. The invention also relates to a cell bank comprising a plurality of disease-associated antigen-specific T cell subpopulations, each subpopulation of T cells being primed by a plurality of subpopulations of antigen presenting cells (APCs), each subpopulation of APCs being genetically modified to express a unique HLA molecule which presents a specific disease-associated antigenic peptide.

The present invention relates to a method for predicting the response of a disease in a subject, preferably a human, to a drug providing 6-mercaptopurine, the method comprising the step of: (i) determining the presence or absence of a variant allele at a polymorphic site in a human leucocyte antigen (HLA)-G gene wherein the presence of said variant allele at said polymorphic site is indicative of clinical response or tolerance to said drug. The invention also provides a method of treating a subject suffering from a condition that would benefit from a drug providing 6-mercaptopurine.