Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Special primer and kit for detecting human leucocyte antigen-B27 (HLA-B27) gene

A technology of HLA-B27 and white blood cell antigen, which is applied in the field of life science and biology, can solve the problem of low detection efficiency, achieve the effect of improving detection efficiency, reducing detection cost, and increasing the maximum sample size

Inactive Publication Date: 2012-02-01
FUZHOU ADICON CLINICAL LAB INC
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A 96-well fluorescent PCR instrument can only detect 45 samples at the same time, and the detection efficiency is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Special primer and kit for detecting human leucocyte antigen-B27 (HLA-B27) gene
  • Special primer and kit for detecting human leucocyte antigen-B27 (HLA-B27) gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The kit for detecting human leukocyte antigen HLA-B27 gene of the present invention comprises:

[0031] Red blood cell lysate;

[0032] DNA extraction solution: TIANGEN tissue / blood / cell genomic DNA extraction kit;

[0033] PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×) (TOYOBO, QPS-101), B27-1 / B27-2 each 0.3uM, B27-probe (probe) 0.2 uM; Gapdh-1 / Gapdh-2 each 0.2 uM, Gapdh-probe (probe) 0.1uM; where B27-1 is: GGGTCTCACACCCTCCAGAAT; B27-2 is: CGGCGGTCCAGGAGCT; B27-probe is FAM-TACCACCAGGACGCCTAC-TAMRA; Gapdh-1 is: CAGGTGGAGCGA GGCTAG; Gapdh-2 is CTACCCATGACTCAGCTTCTCC ; Gapdh-probe: HEX-ACCATGCCA CAGCCACCACCCTC-BHQ1;

[0034] Positive control substance: solution containing HLA-B27 genome;

[0035] Negative control: without HLA-B27 genome solution.

Embodiment 2

[0037] The using method of kit of the present invention:

[0038] (1) Human genomic DNA extraction: Take 300uL of blood and add 900uL of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 10,000 rpm for 1 minute (if the maximum speed of the centrifuge is not allowed, centrifuge at 3,000 rpm for 5 minutes), suck off the supernatant, and leave the white blood cell pellet. Refer to the instructions of TIANGEN Tissue / Blood / Cell Genomic DNA Extraction Kit to extract sample DNA.

[0039] (2) Reagent configuration: Configure X ul of each PCR reaction solution according to the number of people to be tested, and pack in 18ul per person:

[0040] X=18ul reaction solution × (n samples + 1 positive control + 1 negative control + 1 blank control).

[0041] (3) Adding samples: Add 2ul DNA to the PCR reaction solution; directly add 2ul positive control substance and negative control substance to th...

Embodiment 3

[0046] Example 3: Using the nucleic acid detection kit of the present invention to detect clinical specimens

[0047] Take 250 cases of whole blood samples from the clinical PCR group that have tested the HLA-B27 gene (using double-tube fluorescent quantitative PCR technology), and extract the genome, prepare reagents and test according to the method described in Example 2.

[0048] Add 2ul of PCR reaction solution to each sample. At the same time, make positive, negative, and blank controls. A 96-well fluorescent PCR instrument can simultaneously detect 90 samples, a positive control, a negative control and a blank control. The detection time is only 100 minutes.

[0049] The experimental results were compared with the reported results of the PCR group to determine the accuracy of the sample detection. Some positive results are as follows:

[0050] Sample The results of this test PCR test results Sample The results of this test PCR test results 0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a special primer for detecting a human leucocyte antigen-B27 (HLA-B27) gene. The special primer is characterized by comprising an upstream primer B27-1, a downstream primer B27-2 and a probe B27-probe which are used for detecting target genes, and an upstream primer Gapdh-1, a downstream primer Gapdh-2 and a probe Gapdh-probe which are used for detecting an internal control gene, namely glyceraldehyde-3-phosphate dehydrogenase (GAPDH), wherein the B27-1 is shown as GGGTCTCACACCCTCCAGAAT, the B27-2 is shown as CGGCGGTCCAGGAGCT, and the B27-probe is shown as FAM-TACCACCAGGACGCCTAC-TAMRA; and the Gapdh-1 is shown as CAGGTGGAGCGAGGCTAG, the Gapdh-2 is shown as CTACCCATGACTCAGCTTCTCC, and the Gapdh-probe is shown as HEX-ACCATGCCACAGCCACCACACCTC-BHQ1. The invention also provides a kit for detecting the HLA-B27 gene. A method for detecting the gene by using one pipe replaces the original method for detecting the gene by using two pipes, the amount of samples which can be detected by a machine at a time is increased, and the detection efficiency is improved to a great extent.

Description

Technical field [0001] The invention is the field of life science and biotechnology. It specially involves a special primer and kit that detects human white blood cell antigen HLA-B27 genes. It adopts "one tube and double inspection" fluorescent quantitative PCR technology, which can effectively save detection time and improve the detection timeefficiency. Background technique [0002] Ankylosing spondylitis (AS) is a chronic, carrier, and the joints of the middle axis joint.The disease progressed slowly in the early stage, but it developed rapidly in the later period. In a short period of time, humpback deformities, hip, knee and other joints.The diagnosis is mainly based on imaging examination. It lacks laboratory specific diagnostic indicators, which brings difficulties to early diagnosis. It is easy to missed or misdiagnose. Many patients have lost the timing of early treatment and control.Various complications occurred in regular medications, and even caused disability.There...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11G01N21/64
Inventor 方国伟陈巧妙李文静宋坤
Owner FUZHOU ADICON CLINICAL LAB INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com