Special primer and kit for detecting human leucocyte antigen-B27 (HLA-B27) gene
A technology of HLA-B27 and white blood cell antigen, which is applied in the field of life science and biology, can solve the problem of low detection efficiency, achieve the effect of improving detection efficiency, reducing detection cost, and increasing the maximum sample size
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] The kit for detecting human leukocyte antigen HLA-B27 gene of the present invention comprises:
[0031] Red blood cell lysate;
[0032] DNA extraction solution: TIANGEN tissue / blood / cell genomic DNA extraction kit;
[0033] PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×) (TOYOBO, QPS-101), B27-1 / B27-2 each 0.3uM, B27-probe (probe) 0.2 uM; Gapdh-1 / Gapdh-2 each 0.2 uM, Gapdh-probe (probe) 0.1uM; where B27-1 is: GGGTCTCACACCCTCCAGAAT; B27-2 is: CGGCGGTCCAGGAGCT; B27-probe is FAM-TACCACCAGGACGCCTAC-TAMRA; Gapdh-1 is: CAGGTGGAGCGA GGCTAG; Gapdh-2 is CTACCCATGACTCAGCTTCTCC ; Gapdh-probe: HEX-ACCATGCCA CAGCCACCACCCTC-BHQ1;
[0034] Positive control substance: solution containing HLA-B27 genome;
[0035] Negative control: without HLA-B27 genome solution.
Embodiment 2
[0037] The using method of kit of the present invention:
[0038] (1) Human genomic DNA extraction: Take 300uL of blood and add 900uL of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 10,000 rpm for 1 minute (if the maximum speed of the centrifuge is not allowed, centrifuge at 3,000 rpm for 5 minutes), suck off the supernatant, and leave the white blood cell pellet. Refer to the instructions of TIANGEN Tissue / Blood / Cell Genomic DNA Extraction Kit to extract sample DNA.
[0039] (2) Reagent configuration: Configure X ul of each PCR reaction solution according to the number of people to be tested, and pack in 18ul per person:
[0040] X=18ul reaction solution × (n samples + 1 positive control + 1 negative control + 1 blank control).
[0041] (3) Adding samples: Add 2ul DNA to the PCR reaction solution; directly add 2ul positive control substance and negative control substance to th...
Embodiment 3
[0046] Example 3: Using the nucleic acid detection kit of the present invention to detect clinical specimens
[0047] Take 250 cases of whole blood samples from the clinical PCR group that have tested the HLA-B27 gene (using double-tube fluorescent quantitative PCR technology), and extract the genome, prepare reagents and test according to the method described in Example 2.
[0048] Add 2ul of PCR reaction solution to each sample. At the same time, make positive, negative, and blank controls. A 96-well fluorescent PCR instrument can simultaneously detect 90 samples, a positive control, a negative control and a blank control. The detection time is only 100 minutes.
[0049] The experimental results were compared with the reported results of the PCR group to determine the accuracy of the sample detection. Some positive results are as follows:
[0050] Sample The results of this test PCR test results Sample The results of this test PCR test results 0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
