Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

163 results about "Leucocyte antigens" patented technology

Artificial antigen presenting cells and methods of use thereof

InactiveUS20020131960A1Palliating their conditionReduce riskBiocideCompound screeningEpitopeAccessory molecule
The invention provides an artificial antigen presenting cell (AAPC) comprising a eukaryotic cell expressing an antigen presenting complex comprising a human leukocyte antigen (HLA) molecule of a single type, at least one exogenous accessory molecule and at least one exogenous T cell-specific epitope. Methods of use for activation of T lymphocytes are also provided.
Owner:MEMORIAL SLOAN KETTERING CANCER CENT

Tumour-associated peptides binding to human leukocyte antigen (HLA) class i or ii molecules and related Anti-cancer vaccine

The present invention relates to immunotherapeutic methods, and molecules and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. In particular, the present invention relates to two novel peptide sequences derived from HLA class II molecules of human tumour cell lines, which can be used in vaccine compositions for eliciting anti-tumour immune responses.
Owner:IMMATICS BIOTECHNOLOGIES GMBH

Tumor-associated Peptides Binding Promiscuously to Human Leukocyte Antigen (HLA) Class II Molecules

The present invention relates to immunotherapeutic methods, and molecules and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. In particular, the present invention relates to 49 novel peptide sequences derived from HLA class II molecules of human tumour cell lines which can be used in vaccine compositions for eliciting anti-tumour immune responses.
Owner:IMMATICS BIOTECHNOLOGIES GMBH

HLA Class II Deficient Cells, HLA Class I Deficient Cells Capable of Expressing HLA Class II Proteins, and Uses Thereof

The invention provides isolated primate cells preferably human cells that comprise a genetically engineered disruption in a human leukocyte antigen (HLA) class II-related gene, which results in deficiency in MHC class II expression and function. This invention also provides isolated cells further comprising a genetically engineered disruption in a beta-2 microglobulin (B2M) gene, which results in HLA class I / class II deficiency. Also provided are the method of using the cells for transplantation and treating a disease condition.
Owner:UNIV OF WASHINGTON +1

Microfluidic device and leucocyte antigen mediated microfluidic assay

The present invention relates to an leucocyte antigen mediated microfluidic assay and a microfluidic device for analyzing a subjects' body fluids containing leucocytes to determine if the subject has been previously exposed to a predetermined antigen.
Owner:ADVANCED ANIMAL DIAGNOSTICS

Engineering Antiviral T Cell Immunity through Stem Cells and Chimeric Antigen Receptors

The HIV-specific cytotoxic T lymphocyte (CTL) response is a critical component in controlling HIV replication and is an important part of the ultimate failure to eradicate the virus. Disclosed herein are methods for genetically enhancing the HIV-specific CTL response to allow long-term viral suppression or viral clearance. Human hematopoietic stem cells (HSCs) were genetically modified such that they differentiate into mature CTLs that will kill HIV infected cells. As disclosed herein, the functional effector cells are not human leukocyte antigen (HLA)-restricted. As disclosed herein, stem cells are transduced with non HLA-restricted chimeric antigen receptors (CARs) that allow the recognition of HIV or HIV infected cells when expressed by a CTL.
Owner:RGT UNIV OF CALIFORNIA

Novel formulations of tumour-associated peptides binding to human leukocyte antigen (HLA) class i or class ii molecules for vaccine

The present invention relates to novel formulations of tumour-associated peptides binding to human leukocyte antigen (HLA) class I or II molecules as vaccines for the use in immunotherapeutic methods. In particular, the present invention relates to formulations for the immunotherapy of cancer, in particular renal and brain cancer, in particular glioma, especially glioblastoma cancer. The present invention furthermore relates to vaccine compositions for eliciting anti-tumour immune responses.
Owner:IMMATICS BIOTECHNOLOGIES GMBH

Molecular imaging methods for diagnosis and evaluation of ocular and systemic diseases

This invention relates generally to minimally-invasive, in vivo methods of detecting one or more ligands on an intraluminal surface of a blood vessel using microparticles coated with one or more ligand binding partners. More particularly, in certain embodiments, the invention relates to minimally-invasive, in vivo methods of detecting endothelial and leukocyte antigens that are predictive of diabetic retinopathy (DR) and / or other conditions using protein-conjugated microparticles detectable by a non-invasive detection system, for example, a scanning laser opthalmoscope. In other embodiments, the invention relates to targeted delivery of drugs or other substances to specific regions of an intraluminal surface of a blood vessel using drug-containing microparticles coated with one or more ligand binding partners.
Owner:MASSACHUSETTS EYE & EAR INFARY

Tumor-associated Peptides Binding Promiscuously to Human Leukocyte Antigen (HLA) Class II Molecules

The present invention relates to immunotherapeutic methods, and molecules and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. In particular, the present invention relates to 49 novel peptide sequences derived from HLA class II molecules of human tumour cell lines which can be used in vaccine compositions for eliciting anti-tumour immune responses.
Owner:IMMATICS BIOTECHNOLOGIES GMBH

HLA high-resolution gene sequencing kit

InactiveCN101892317AAvoid problems that cannot be effectively typedHigh resolutionMicrobiological testing/measurementDNA/RNA fragmentationHLA-BExon
The invention discloses a parting method of leucocyte antigen gene of human being, comprising the following steps of: (1) extracting genome DNA to be tested by a regular technology, and amplifying a destination gene fragment to be analyzed by using PCR amplification primer: 2,3,4 exon of HLA-A, 2,3,4 exon of HLA-B and exon on the locus 2 of HLA-DRB; and (2) amplifying the PCR output obtained in the step (1) by using sequencing primer, amplifying the exon, sequencing the amplified exon and comparing the sequencing result with the standard sequence in a database to determine the gene parting result. As the 2,3,4 exon of HLA-A, 2,3,4 exon of HLA-B and exon on the locus 2 of HLA-DRB are effectively amplified as a result of optimized combination of the HLA gene sequencing kit and the test condition, and the corresponding exon is sequenced, the invention solves the problem that effective parting can not be performed when certain allelic gene nucleotide is located outside an amplification area during further parting, thereby improving the parting resolution and accuracy of the HLA gene.
Owner:SUZHOU UNIV +1

Tumor-associated peptides binding to human leukocyte antigen (HLA) class II molecules

The present invention relates to immunotherapeutic methods, and molecules and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. In particular, the present invention relates to 49 novel peptide sequences derived from HLA class II molecules of human tumour cell lines which can be used in vaccine compositions for eliciting anti-tumour immune responses.
Owner:IMMATICS BIOTECHNOLOGIES GMBH

Universal donor stem cells and related methods

ActiveUS20190309259A1Reduce and eliminate and activityReduce and eliminate surface expressionGenetically modified cellsStable introduction of DNAHLA-BImmunogenicity
Disclosed herein are universal donor stem cells and related methods of their use and production. The universal donor stem cells disclosed herein are useful for overcoming the immune rejection in cell-based transplantation therapies. In certain embodiments, the universal donor stem cells disclosed herein do not express one or more MHC-I and MHC-II human leukocyte antigens. Similarly, in certain embodiments, the universal donor stem cells disclosed herein do not express one or more human leukocyte antigens (e.g., HLA-A, HLA-B and / or HLA-C) corresponding to MHC-I and MHC-II human leukocyte antigens, thereby rendering such cells hypoimmunogenic.
Owner:PRESIDENT & FELLOWS OF HARVARD COLLEGE

Improved HLA epitope prediction

Adaptive immune responses rely on the ability of cytotoxic T cells to identify and eliminate cells displaying disease-specific antigens on human leukocyte antigen (HLA) class I molecules. Investigations into antigen processing and display have immense implications in human health, disease and therapy. To extend understanding of the rules governing antigen processing and presentation, immunopurified peptides from B cells, each expressing a single HLA class I allele, were profiled using accurate mass, high-resolution liquid chromatography-mass spectrometry (LC-MS / MS). A resource dataset containing thousands of peptides bound to 28 distinct class I HLA-A, -B, and -C alleles was generated by implementing a novel allele-specific database search strategy. Applicants discovered new binding motifs, established the role of gene expression in peptide presentation and improved prediction of HLA-peptide binding by using these data to train machine-learning models. These streamlined experimental and analytic workflows enable direct identification and analysis of endogenously processed and presented antigens.
Owner:THE BROAD INST INC +4

Chimeric human leukocyte antigen and epitope-bearing molecules having immunosuppressant activity

The present invention relates to chimeric molecules that comprise human major histocompatibility complex elements, linked to epitopes of interest, that have been joined together to form dimers or higher multimers. Such chimeric molecules may be used to treat or prevent diseases associated with autoimmunity, particularly diabetes. It is based, at least in part, on the discovery that a chimeric molecule comprising an IILA-DR element linked to an epitope of GAD65, an antigen associated with autoimmune diabetes, stimulated the secretion of the inhibitory cytokine IL-10 from CD4 T cells of Type I diabetic patients.
Owner:MT SINAI SCHOOL OF MEDICINE

Microfluidic device and leucocyte antigen mediated microfluidic assay

The present invention relates to an leucocyte antigen mediated microfluidic assay and a microfluidic device for analyzing a subjects' body fluids containing leucocytes to determine if the subject has been previously exposed to a predetermined antigen.
Owner:ADVANCED ANIMAL DIAGNOSTICS

Tumor-associated Peptides Binding Promiscuously to Human Leukocyte Antigen (HLA) Class II Molecules

The present invention relates to immunotherapeutic methods, and molecules and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumour-associated T-helper cell peptide epitopes, alone or in combination with other tumour-associated peptides, that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumour immune responses. In particular, the present invention relates to 49 novel peptide sequences derived from HLA class II molecules of human tumour cell lines which can be used in vaccine compositions for eliciting anti-tumour immune responses.
Owner:IMMATICS BIOTECHNOLOGIES GMBH

Compositions and methods for detecting sla reactivity

In human-human transplants, the organ recipient's serum is tested against a broad array of HLA (human leukocyte antigens) alleles. The current clinical assay almost performs a virtual crossmatch which allows elimination of incompatible donor organs in advance, but the current assay presents fragments of HLA polypeptides that are not normally visible to antibodies. As a result, the assay yields false positives. Further the current clinical assay is optimized for human to human transplant, not swine to human transplant. Some HLA antibodies also bind swine leukocyte antigens (SLA). Rather than using beads to present antigens, the compositions and methods provide cellular presentation of potential antigens. The application provides a modified human C1R cell line with significantly reduced antigenicity to human sera. Multiple cell lines, each expressing a different SLA, were created. The modified C1R line may express HLAs or other potential antigens of interest. The application also provides modified HEK293T cells for antigen display.
Owner:INDIANA UNIV RES & TECH CORP

Human leukocyte antigen gene detection kit and application thereof

PendingCN106282328AContribute to the establishment of a method for screening drug eruptions caused by metronidazoleTo establish a method for screening metronidazole-induced drug eruptionMicrobiological testing/measurementMetaboliteWhite blood cell
The invention belongs to the fields of biomedicine and reagent detection, and relates to a human leukocyte antigen gene detection kit and application thereof in screening metronidazole-induced adverse drug reactions of skin. The kit contains a reagent for detecting human leukocyte antigen gene HLA-B*39:01 nucleic acid or protein, and amplification primers or a labeled probe of the human leukocyte antigen gene or a specific antibody containing the human leukocyte antigen. The HLA-B*39:01 gene can be used as a labeled gene for predicting metronidazole-induced epispasis. The detection kit can be used for further preparing or evaluating a metronidazole-induced epispasis screening kit, thereby providing valuable reference data for instructing clinical medication, and reducing the possibility of metronidazole-induced epispasis; or the detection kit can also be used for preparing or evaluating therapeutic drugs and especially targeted drugs for metronidazole-induced epispasis, thereby preventing the interactions between the drugs and metronidazole or metabolites thereof in disease development.
Owner:FUDAN UNIV +1

Hla-restricted epitopes encoded by somatically mutated genes

Mutant epitopes encoded by cancer genes are virtually always located in the interior of cells, making them invisible to conventional antibodies. We generated single chain variable fragments (scFvs) specific for mutant peptides presented on the cell surface by human leukocyte antigen (HLA) molecules. These scFvs can be converted to full-length antibodies, termed MANAbodies, targeting “Mutation Associated Neo-Antigens” bound to HLA. A phage display library representing a highly diverse array of single-chain variable fragment sequences was first designed and constructed. A competitive selection protocol was then used to identify clones specific for peptides bound to pre-defined HLA types. In this way, we obtained scFvs, including one specific for a peptide encoded by a common KRAS mutant and another by a common EGFR mutant. Molecules targeting MANA can be developed that specifically react with mutant peptide-HLA complexes even when these peptides differ by only one amino acid from the normal, wild-type form.
Owner:THE JOHN HOPKINS UNIV SCHOOL OF MEDICINE

Kit and method for detecting human leucocyte antigen HLA-B*1502 genetype

The invention discloses a kit and a method for detecting human leucocyte antigen HLA-B*1502 genetype. The kit disclosed by the invention is characterized by comprising the following primer sequences: a forward primer FP: 5'-CGACGCCGCGAGTCCCAGG-3'; and a reverse primer RP: 5'-CGTCGTAGGCGGACTGGTCATA-3'. The kit further comprises the following probe sequence: a probe PR: 5'-Cy5-AACACACAGATCTCCAAGACCAACACAC-p-3'. The kit disclosed by the invention has good specificity and sensitivity for carrying out PCR (Polymerase Chain Reaction) detection of the human leucocyte antigen HLA-B*1502. The PCR detection method disclosed by the invention has the advantages of being simple for operation (closed pipe), rapid, accurate and the like and is applied to clinical molecular diagnosis.
Owner:瀚吉康生物科技(北京)有限公司

Cancer vaccine composition

Disclosed is a cancer vaccine composition for a human leukocyte antigen (HLA)-A*0206-positive subject, which is characterized by comprising a protein which is a gene product of a tumor suppressor gene WT1 or a partial peptide of the protein.
Owner:INT INST OF CANCER IMMUNOLOGY INC

Universal donor stem cells and related methods

ActiveUS10968426B2Reduce and eliminate and activityReduce and eliminate expressionGenetically modified cellsStable introduction of DNAWhite blood cellImmunogenicity
Disclosed herein are universal donor stem cells and related methods of their use and production. The universal donor stem cells disclosed herein are useful for overcoming the immune rejection in cell-based transplantation therapies. In certain embodiments, the universal donor stem cells disclosed herein do not express one or more MHC-I and MHC-II human leukocyte antigens. Similarly, in certain embodiments, the universal donor stem cells disclosed herein do not express one or more human leukocyte antigens (e.g., HLA-A, HLA-B and / or HLA-C) corresponding to MHC-I and MHC-II human leukocyte antigens, thereby rendering such cells hypoimmunogenic.
Owner:PRESIDENT & FELLOWS OF HARVARD COLLEGE

Novel formulations of tumour-associated peptides binding to human leukocyte antigen (HLA) class i or class ii molecules for vaccines

The present invention relates to novel formulations of tumour-associated peptides binding to human leukocyte antigen (HLA) class I or II molecules as vaccines for the use in immunotherapeutic methods. In particular, the present invention relates to formulations for the immunotherapy of cancer, in particular renal and brain cancer, in particular glioma, especially glioblastoma cancer. The present invention furthermore relates to vaccine compositions for eliciting anti-tumour immune responses.
Owner:IMMATICS BIOTECHNOLOGIES GMBH

SPA-antibody tripolymer, cell treating kit containing tripolymer, preparation method and application thereof

The invention relates to an SPA-antibody tripolymer, a cell treating kit containing the tripolymer, a preparation method and application thereof. The tripolymer comprises an anti erythrocyte antibody, an SPA and an antibody of a certain anti leukocyte antigen or other antigens. The tripolymer is combined with an erythrocyte through the anti erythrocyte antibody per se, the other antibody is combined with a corresponding leukocyte antigen (or other antigens), and then leukocyte (other cells, factors) and the erythrocyte are deposited through an erythrocyte sedimentation process or other methods of density gradient centrifugation and the like, thereby achieving the purpose of eliminating ingredients of corresponding cells and the like, connecting the erythrocyte with a corresponding antigen by the SPA, and being used as a mean for detecting a certain antigen. The invention has convenience and simpleness, and can be directly used for clinically separating and extracting stem cells / progenitor cells; and the collected and extracted stem cells / progenitor cells have no external markers. Meanwhile, the kit based on the tripolymer can be industrially produced so as to realize the popularization of the separation and purification technology of hematopoietic stem cells.
Owner:王信

Animal model with human immune system

InactiveUS20150282460A1Increase translatabilityCompounds screening/testingFermentationHuman cellImmunodeficiency
The present disclosure provides an immuno-deficient animal useful as an animal model for a human disease, wherein the animal comprises: (a) functional human immune cells; and (b) a human xenograft comprising a pathogenic human cell or tissue, wherein the human immune cells and the human xenograft meet at least one of the following criteria: i) the human xenograft expresses a threshold level of a therapeutic target for the human disease; ii) the human immune cells match with the human xenograft for at least one human leukocyte antigen (HLA) marker; and iii) the human xenograft cells expresses a desired level of the matched HLA marker. Also provides is a method of producing the animal model and use of the animal models.
Owner:CROWN BIOSCI INC TAICANG

Special primer and kit for detecting human leucocyte antigen-B27 (HLA-B27) gene

The invention discloses a special primer for detecting a human leucocyte antigen-B27 (HLA-B27) gene. The special primer is characterized by comprising an upstream primer B27-1, a downstream primer B27-2 and a probe B27-probe which are used for detecting target genes, and an upstream primer Gapdh-1, a downstream primer Gapdh-2 and a probe Gapdh-probe which are used for detecting an internal control gene, namely glyceraldehyde-3-phosphate dehydrogenase (GAPDH), wherein the B27-1 is shown as GGGTCTCACACCCTCCAGAAT, the B27-2 is shown as CGGCGGTCCAGGAGCT, and the B27-probe is shown as FAM-TACCACCAGGACGCCTAC-TAMRA; and the Gapdh-1 is shown as CAGGTGGAGCGAGGCTAG, the Gapdh-2 is shown as CTACCCATGACTCAGCTTCTCC, and the Gapdh-probe is shown as HEX-ACCATGCCACAGCCACCACACCTC-BHQ1. The invention also provides a kit for detecting the HLA-B27 gene. A method for detecting the gene by using one pipe replaces the original method for detecting the gene by using two pipes, the amount of samples which can be detected by a machine at a time is increased, and the detection efficiency is improved to a great extent.
Owner:FUZHOU ADICON CLINICAL LAB INC

Detection kit for human leucocyte antigen genes

The invention belongs to the technical field of biological medicines and relates to a detection kit for human leucocyte antigen (HLA) genes--HLA-B*59: 01 genes, and the HLA-B*59: 01 genes can serve as marker genes for forecasting methazolamide caused SJS (Stevens-Johnson syndrome) and TEN (Toxic epidermal necrolysis). According to the detection kit, after DNA extracted from the peripheral blood of a patient, the PCR-SSO method is adopted to detect the HLA-B*59 :01 genes. The detection kit for HLA-B*59: 01 genes can be used for examining before application of methazolamide and screening targeted medicines for treating methazolamide caused SJS and TEN; and examination can guide clinical medication to reduce incidence of SJS and TEN caused by methazolamide, and the screening mainly acts on HLA-B*59: 01 molecules in a targeted manner, so that interaction between the HLA-B*59: 01 molecules and methazolamide or other metabolic products during attack.
Owner:AFFILIATED HUSN HOSPITAL OF FUDAN UNIV +1

Composition for Treating Baldness with Stem Cell Derived From Umbilical Cord Blood

Provided is a therapeutic technique for treating baldness, using an umbilical cord blood-derived stem cell. Transplantation of a composition for treating baldness into a bald area of a patient can make great contributions to treatment for baldness, wherein the composition comprises stem cells isolated and cultured from umbilical cord blood in which 6 HLA (Human Leukocyte Antigen) are identical with a patient, or one or two HLA are not identical with the patient.
Owner:HAN HOON