Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group, probe and kit for detecting schistosoma haematobium

A technology of schistosomiasis and kit, which is applied in the field of primers, probes and kits for detecting Schistosoma haematobium, can solve the problems of high cost, high false positive, cumbersome and difficult pathogen isolation and cultivation, and achieve simple operation, strong specificity, The effect of high sensitivity and accuracy

Pending Publication Date: 2020-03-27
JIANGSU INST OF PARASITIC DISEASES +1
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Based on this, it is necessary to provide a primer set, probe and kit for detecting Schistosoma haematobium in view of the traditional detection methods of Schistosoma haematobium or the technical problems of cumbersome and difficult isolation and culture of pathogens, high false positives, or high cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group, probe and kit for detecting schistosoma haematobium
  • Primer group, probe and kit for detecting schistosoma haematobium
  • Primer group, probe and kit for detecting schistosoma haematobium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] The composition of the kit is shown in Table 1. Among them, the primers and probes in this example were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., and passed the HPLC test. The fluorescent reporter group of the probe is FAM. The killing group is BHQ1. The modified probe is CTGTGGGTCTCGTGTATGAGATCCTATAGT / i6FAMdT / T / idSp / A / iBHQ1dT / GATTGGTTGGTTTTA.

[0061] The kit composition of table 1 embodiment 1

[0062]

[0063] Sensitivity Evaluation Test

[0064] Transfer 5 μL of Schistosoma haematobium gene recombinant DNA plasmid into Escherichia coli and extract it at a concentration of 10 10 Copies / μL DNA plasmids are used to make working standards of different gradients, which are:

[0065] Working Standard 1, containing 1.0 × 10 6 copies / μL of a non-infectious DNA fragment of the Schistosoma haematobium COX1 gene;

[0066] Working Standard 2, containing 1.0 × 10 5 copies / μL non-infectious DNA fragment of Schistosoma haematobium COX1 gene, equivalent to...

Embodiment 2 to 8

[0093] Adopt the kit identical with embodiment 1, identical method carries out sensitivity evaluation test, Schistosoma haematobium sample detection test and specificity evaluation test respectively, differs from embodiment 1 in that the reaction temperature and reaction time of instrument setting are different, specifically The difference is shown in Table 2.

[0094] The reaction conditions of table 2 embodiment 2 to 8

[0095] Example Reaction temperature / ℃ Reaction time / min Example 2 30 15 Example 3 35 18 Example 4 37 20 Example 5 40 22 Example 6 42 25 Example 7 30 25 Example 8 42 15

[0096] The test results of Examples 2 to 8 are similar to those of Example 1, with high sensitivity and specificity and good repeatability.

Embodiment 9

[0098] The composition of the kit is shown in Table 3, wherein the fluorescent reporter group of the probe in this embodiment is FAM, and the quencher group is BHQ1.

[0099] The kit composition of table 3 embodiment 9

[0100]

[0101]

[0102] The sensitivity evaluation test, Schistosoma haematobium sample detection test and specificity evaluation test were carried out using the same method and test conditions as in Example 1. The test results were similar to those in Example 1, with high sensitivity and specificity and good repeatability.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer group for detecting schistosoma haematobium. The primer group comprises an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shownas SEQ ID No. 1; and the sequence of the downstream primer is shown as SEQ ID No. 2. The primer group, probe and kit for detecting the schistosoma haematobium are simple and convenient to operate; tests prove that when the primer group, probe and kit for detecting the schistosoma haematobium are used for detecting the schistosoma haematobium, the specificity is high, the sensitivity and the accuracy are high, the repeatability is good, a detection result can be obtained within 20 minutes, the requirements on detection conditions and the technical requirements of detection personnel are low, and the detection cost is low.

Description

technical field [0001] The invention relates to the technical field of molecular biology detection, in particular to a primer set, a probe and a kit for detecting Schistosoma aegyptium. Background technique [0002] Schistosomiasis is an infectious disease caused by global poverty that seriously endangers human health and affects social and economic development. The schistosomes that parasitize the human body mainly include Schistosoma japonicum, Schistosoma haematobium, Schistosoma mansoni, Schistosoma intercalatum and Schistosoma Mekong. Among them, Schistosoma haematobium is mainly distributed in Africa, Asia, Africa, the Nile River Basin of Egypt, Sudan, the Maghreb region and Arabia peninsula. [0003] Schistosoma haematobium belongs to the platyhelminth phylum. The life cycle of Schistosoma haematobium includes two stages, that is, the sexual reproduction generation completed in the final host (human or other mammals) and the asexual generation completed in the inter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6893C12Q1/6844C12N15/11
CPCC12Q1/6893C12Q1/6844C12Q2521/507C12Q2522/101
Inventor 杨坤张键锋赵松王鑫瑶刘燕红应清界
Owner JIANGSU INST OF PARASITIC DISEASES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com