Primer group, probe and kit for detecting schistosoma haematobium
A technology of schistosomiasis and kit, which is applied in the field of primers, probes and kits for detecting Schistosoma haematobium, can solve the problems of high cost, high false positive, cumbersome and difficult pathogen isolation and cultivation, and achieve simple operation, strong specificity, The effect of high sensitivity and accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] The composition of the kit is shown in Table 1. Among them, the primers and probes in this example were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., and passed the HPLC test. The fluorescent reporter group of the probe is FAM. The killing group is BHQ1. The modified probe is CTGTGGGTCTCGTGTATGAGATCCTATAGT / i6FAMdT / T / idSp / A / iBHQ1dT / GATTGGTTGGTTTTA.
[0061] The kit composition of table 1 embodiment 1
[0062]
[0063] Sensitivity Evaluation Test
[0064] Transfer 5 μL of Schistosoma haematobium gene recombinant DNA plasmid into Escherichia coli and extract it at a concentration of 10 10 Copies / μL DNA plasmids are used to make working standards of different gradients, which are:
[0065] Working Standard 1, containing 1.0 × 10 6 copies / μL of a non-infectious DNA fragment of the Schistosoma haematobium COX1 gene;
[0066] Working Standard 2, containing 1.0 × 10 5 copies / μL non-infectious DNA fragment of Schistosoma haematobium COX1 gene, equivalent to...
Embodiment 2 to 8
[0093] Adopt the kit identical with embodiment 1, identical method carries out sensitivity evaluation test, Schistosoma haematobium sample detection test and specificity evaluation test respectively, differs from embodiment 1 in that the reaction temperature and reaction time of instrument setting are different, specifically The difference is shown in Table 2.
[0094] The reaction conditions of table 2 embodiment 2 to 8
[0095] Example Reaction temperature / ℃ Reaction time / min Example 2 30 15 Example 3 35 18 Example 4 37 20 Example 5 40 22 Example 6 42 25 Example 7 30 25 Example 8 42 15
[0096] The test results of Examples 2 to 8 are similar to those of Example 1, with high sensitivity and specificity and good repeatability.
Embodiment 9
[0098] The composition of the kit is shown in Table 3, wherein the fluorescent reporter group of the probe in this embodiment is FAM, and the quencher group is BHQ1.
[0099] The kit composition of table 3 embodiment 9
[0100]
[0101]
[0102] The sensitivity evaluation test, Schistosoma haematobium sample detection test and specificity evaluation test were carried out using the same method and test conditions as in Example 1. The test results were similar to those in Example 1, with high sensitivity and specificity and good repeatability.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com