DNA nano-material, and preparation method and application thereof
A nanomaterial and nanogold technology, applied in the field of DNA nanomaterials and its preparation, can solve the problems of large non-target cell toxicity, poor intracellular stability, and low specificity, and achieve the effect of wide application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] A method for the preparation of circular templates that mediate the synthesis of DNA nanomaterials: 1 µL each of the circular strands pL1 and pL2 at a concentration of 10 µM, 1 µL each of the blocking templates T1 and T2 at a concentration of 10 µM, and 2 µL T4 DNA ligation Enzyme buffer was added to 13 µL ddH 2 O, after mixing well, the resulting solution was annealed at 90°C for 5 minutes, then cooled to room temperature; subsequently, 1 µL of 350 U / µL T4 DNA ligase was added and incubated at 16°C for 16 hours, then at 65°C Heating for 10 minutes denatures the ligase to create a circular template.
[0031] The nucleotide sequence of the above circular chain pL1 is: PL1: 5'-AAACGCATGCAAAAAGATCTATAAATAGCGAAAACTAGAAAAAAAGCATGCGAACCATAT-3'; the nucleotide sequence of the circular chain PL2 is: PL2: 5'-AAAACTTAGGAAAAATTCTAGTAAATAGCGAAAATAGATCAAAACCTAAGTAAA CATAT-3'; the nucleotide sequence of the sealing template T1 The acid sequence is: T1: 5'-GATCTTTTTGCATGCGTTTATATGTTT...
Embodiment 2
[0034] A method for preparing DNA nanomaterials mediated by circular template-mediated synthesis of DNA nanostrip lattice ribbon-AS1411 complexes (RDL2-AS1411): add 2 μL of rolling circle amplification (RCA) products at a concentration of 15 μM, and 2 μL at a concentration of 10 μM SS1, 2 μL of SS1-AS1411 aptamer at a concentration of 10 μM, 2 μL of SS2 at a concentration of 10 μM and 2 μL of 125 mM Mg 2+ 10x TAE buffer was sequentially added to 12 μL ddH 2 O and mixed thoroughly, then the resulting mixed solution was heated at 90 °C for 5 min, and then cooled to room temperature to prepare the DNA nanomaterial RDL2-AS1411.
[0035] The method for preparing the above rolling circle amplification (RCA) product is: 20ul of the circular template prepared in Example 1, add 4 µL of 10x phi29 buffer, 1 µL of 10 mM dNTP and 0.5 µL of 10 U / μL of phi29 polymerase, Add ddH 2 O to a total volume of 40 μL, incubate at 30°C for 30 minutes; then heat at 65°C for 10 minutes to inactivate p...
Embodiment 3
[0039] A method for preparing a ring template-mediated synthesis of nano gold-DNA nanolattice ribbon complex (Au-R2A) DNA nanomaterials, comprising the following steps:
[0040] (1) Nano-gold primer (Au-Primer): 100ul of sulfhydryl-modified primer sequence with a concentration of 10uM was uniformly mixed with 500uL nano-gold to obtain the nano-gold primer Au-Primer;
[0041] (2) Nano-gold rolling circle product (Au-RP): Mix the nano-gold primer modified with the rolling circle primer in step (1) with the circular template prepared in Example 1 at a molar ratio of 1:100, and then take 20ul Add 4 µL of 10x phi29 buffer to the mixture, 1 µL of 10 mM dNTPs and 0.5 µL of 10 U / µL phi29 polymerase, add ddH 2 O to 40 μL, incubate at 30°C for 30 minutes, then heat at 65°C for 10 minutes to inactivate phi29 polymerase, and obtain the nano-gold rolling circle product Au-RP;
[0042] (3) Nanogold-DNA nanolattice ribbon complex (Au-R2A): 120uL of the nanogold rolling circle product Au-RP ...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap