DNA nano-material, and preparation method and application thereof

A nanomaterial and nanogold technology, applied in the field of DNA nanomaterials and its preparation, can solve the problems of large non-target cell toxicity, poor intracellular stability, and low specificity, and achieve the effect of wide application value

Pending Publication Date: 2020-04-17
FUZHOU UNIV
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Traditional drug delivery carriers such as liposomes and polymers have low specificity and high non-target cytotoxicity; inorganic nanoparticles have low cell uptake rate and poor intracellular stability; in recent years, DNA-assembled As a drug delivery carrier, nanomaterials can reduce the toxicity of cells and tissues, reduce the difficulty of drug delivery routes, and are expected to achieve coordinated transport. However, the current DNA nanostructures still have many defects such as complex structural design and low drug loading.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA nano-material, and preparation method and application thereof
  • DNA nano-material, and preparation method and application thereof
  • DNA nano-material, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] A method for the preparation of circular templates that mediate the synthesis of DNA nanomaterials: 1 µL each of the circular strands pL1 and pL2 at a concentration of 10 µM, 1 µL each of the blocking templates T1 and T2 at a concentration of 10 µM, and 2 µL T4 DNA ligation Enzyme buffer was added to 13 µL ddH 2 O, after mixing well, the resulting solution was annealed at 90°C for 5 minutes, then cooled to room temperature; subsequently, 1 µL of 350 U / µL T4 DNA ligase was added and incubated at 16°C for 16 hours, then at 65°C Heating for 10 minutes denatures the ligase to create a circular template.

[0031] The nucleotide sequence of the above circular chain pL1 is: PL1: 5'-AAACGCATGCAAAAAGATCTATAAATAGCGAAAACTAGAAAAAAAGCATGCGAACCATAT-3'; the nucleotide sequence of the circular chain PL2 is: PL2: 5'-AAAACTTAGGAAAAATTCTAGTAAATAGCGAAAATAGATCAAAACCTAAGTAAA CATAT-3'; the nucleotide sequence of the sealing template T1 The acid sequence is: T1: 5'-GATCTTTTTGCATGCGTTTATATGTTT...

Embodiment 2

[0034] A method for preparing DNA nanomaterials mediated by circular template-mediated synthesis of DNA nanostrip lattice ribbon-AS1411 complexes (RDL2-AS1411): add 2 μL of rolling circle amplification (RCA) products at a concentration of 15 μM, and 2 μL at a concentration of 10 μM SS1, 2 μL of SS1-AS1411 aptamer at a concentration of 10 μM, 2 μL of SS2 at a concentration of 10 μM and 2 μL of 125 mM Mg 2+ 10x TAE buffer was sequentially added to 12 μL ddH 2 O and mixed thoroughly, then the resulting mixed solution was heated at 90 °C for 5 min, and then cooled to room temperature to prepare the DNA nanomaterial RDL2-AS1411.

[0035] The method for preparing the above rolling circle amplification (RCA) product is: 20ul of the circular template prepared in Example 1, add 4 µL of 10x phi29 buffer, 1 µL of 10 mM dNTP and 0.5 µL of 10 U / μL of phi29 polymerase, Add ddH 2 O to a total volume of 40 μL, incubate at 30°C for 30 minutes; then heat at 65°C for 10 minutes to inactivate p...

Embodiment 3

[0039] A method for preparing a ring template-mediated synthesis of nano gold-DNA nanolattice ribbon complex (Au-R2A) DNA nanomaterials, comprising the following steps:

[0040] (1) Nano-gold primer (Au-Primer): 100ul of sulfhydryl-modified primer sequence with a concentration of 10uM was uniformly mixed with 500uL nano-gold to obtain the nano-gold primer Au-Primer;

[0041] (2) Nano-gold rolling circle product (Au-RP): Mix the nano-gold primer modified with the rolling circle primer in step (1) with the circular template prepared in Example 1 at a molar ratio of 1:100, and then take 20ul Add 4 µL of 10x phi29 buffer to the mixture, 1 µL of 10 mM dNTPs and 0.5 µL of 10 U / µL phi29 polymerase, add ddH 2 O to 40 μL, incubate at 30°C for 30 minutes, then heat at 65°C for 10 minutes to inactivate phi29 polymerase, and obtain the nano-gold rolling circle product Au-RP;

[0042] (3) Nanogold-DNA nanolattice ribbon complex (Au-R2A): 120uL of the nanogold rolling circle product Au-RP ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DNA nano-material, and a preparation method and an application thereof, and belongs to the technical field of nano-materials. A DNA nano-stripe band is designed on the basis of a DNA origami theory, the nano-stripe is characterized in that a rolling circle amplification reaction product obtained through rolling circle reaction amplification of a ring template with a special structure is self-assembled to form a DNA nano-crystal lattice, and the DNA nano-crystal lattice is modified with an AS1411 aptamer of targeted nucleolin to form a DNA nano-material DNA nanostripe crystal lattice band-AS1411 compound; and the DNA nano-strip crystal lattice band-AS1411 compound is combined with nano-gold balls to form the DNA nano-material nano-gold-DNA nano-crystal lattice bandcompound. The prepared DNA nano-material has wide application values in tumor diagnosis and treatment as a targeting drug carrier.

Description

technical field [0001] The invention belongs to the technical field of nanomaterials, and in particular relates to a DNA nanomaterial and its preparation method and application. Background technique [0002] As we all know, today's human life and health are facing the threat of many major and difficult diseases such as cancer, and anticancer drugs in the traditional sense have great potential threats. In order to improve the performance of traditional drugs and make up for the defects of traditional anticancer drugs, the development of suitable drug delivery vehicles has become a hot spot for researchers in the field of biotechnology and medicine. [0003] Traditional drug delivery carriers such as liposomes and polymers have low specificity and high non-target cytotoxicity; inorganic nanoparticles have low cell uptake rate and poor intracellular stability; in recent years, DNA-assembled As a drug delivery carrier, nanomaterials can reduce the toxicity of cells and tissues,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12N15/11A61K47/26A61K47/54A61K47/02A61K31/704A61P35/00B82Y30/00B82Y40/00
CPCC12N15/10C12N15/11A61K47/26A61K47/549A61K47/02A61K31/704A61P35/00B82Y30/00B82Y40/00Y02A50/30
Inventor吴再生陈畅张书馨李应福
OwnerFUZHOU UNIV