Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting human breast cancer susceptibility genotyping and use method and application thereof

A susceptibility gene, breast cancer technology, applied in the fields of biotechnology and medicine, can solve the problems of laborious experimental operation, laborious cost, and high total amount of DNA samples required, and achieve the effects of low cost, low cost, high accuracy and sensitivity

Pending Publication Date: 2020-04-24
GENETALKS BIO TECH CHANGSHA CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, methods for detecting breast cancer risk susceptibility genes include enzyme digestion, sequencing, and fluorescent quantitative PCR technology. However, the above methods require a high amount of DNA samples, and the experimental operation is laborious, laborious, and costly.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting human breast cancer susceptibility genotyping and use method and application thereof
  • Kit for detecting human breast cancer susceptibility genotyping and use method and application thereof
  • Kit for detecting human breast cancer susceptibility genotyping and use method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] 1. Primer design

[0073] S1: According to the following loci of human breast cancer risk susceptibility genes, rs2241766, rs2273535, rs4680, rs4880, rs28897756 and rs55770810 were extracted from the NCBI dbSNP database for reference sequences, and primers were designed:

[0074] The sequence of the first set of primers (primer set for rs2241766 site) is as follows:

[0075] Rs2241766FF (SEQ ID No. 1):

[0076] GAAGGTGACCAAGTTCATGCTAGTCGTGGTTTCCTGGTCATGC;

[0077] Rs2241766FH (SEQ ID No. 2):

[0078] GAAGGTCGGAGTCAACGGATTGAGTCGTGGTTTCCTGGTCATGA;

[0079] Rs2241766R (SEQ ID No. 3): GCTGGGAGCTGTTCTACTGCTATTA;

[0080] The sequence of the second set of primers (primer set for the rs2273535 site) is as follows:

[0081] Rs2273535FF (SEQ ID No. 4):

[0082] GAAGGTGACCAAGTTCATGCTCAGGTAATGGATTCTGACAAGGAAA;

[0083] Rs2273535FH (SEQ ID No. 5):

[0084] GAAGGTCGGAGTCAACGGATTCAGGTAATGGATTCTGACAAGGAAT;

[0085] Rs2273535R (SEQ ID No. 6): CATTCTAGGCTACAGCTCCAGTTG;

[0086...

Embodiment 2

[0136] The DNA of YG09000968 sample was taken and diluted to 10ng / μl, 5ng / μl, 1ng / μl and 0.5ng / μl in sequence, and tested according to the method in Example 1. The results are shown in Table 5 below:

[0137] Table 5. Genotyping detection results of different concentrations of DNA samples

[0138] site 10ng / μl 5ng / μl 1ng / μl 0.5ng / μl rs2241766 GT GT GT - rs2273535 TT TT TT - rs4680 AAA AAA AAA - rs4880 AAA AAA AAA AAA rs28897756 GG GG GG GG rs55770810 GG GG GG GG

[0139] The invention can detect DNA samples above 1ng / μl. It can be seen from the experimental results that this solution still has high sensitivity and high accuracy for the detection of low-concentration DNA samples, and the sample concentration can be as low as 1ng / μl.

[0140] In summary, the kit for detecting human breast cancer susceptibility genotyping provided by the present invention can detect human breast cancer sus...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting human breast cancer susceptibility genotyping and a use method and application of the kit. The kit comprises a primer group, the primer group is primers which are respectively designed for six detection sites rs2241766, rs2273535, rs4680, rs4880, rs28897756 and rs55770810 of a human breast cancer susceptibility gene, and the primers are primers which aredesigned for six detection sites rs2241766, rs2273535, rs4680, rs4880, rs2889756 and rs5770810. The primers specifically comprise three corresponding primers, namely an upstream primer FAM, an upstream primer HEX and a downstream primer. According to the use method of the kit, a KASP technology is adopted for genotyping detection on six detection sites of the human breast cancer susceptibility gene by adopting a KASP technology; the kit and the use method thereof have the advantages of high detection sensitivity, high accuracy, low required quantity of required DNA samples, convenience in operation, low cost and the like.

Description

technical field [0001] The invention relates to the fields of biotechnology and medicine, in particular to a kit for detecting susceptibility genotyping of human breast cancer and its use method and application. Background technique [0002] Breast cancer is one of the most common malignant tumors in women, and can be divided into sporadic breast cancer and familial breast cancer according to its pathogenic characteristics. Familial breast cancer patients refer to two or more blood-related members of a family suffering from breast cancer, which account for about 20% of the total breast cancer. Family history is one of the important risk factors for breast cancer, which may be The result of the interaction of genetic and environmental factors. In 1990, researchers discovered a gene related to hereditary breast cancer located on chromosome 17 of the human nucleus, and named it breast cancer susceptibility gene No. 1, or BRCA1 for short. BRCA2 is located in the region of chro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886
Inventor 王益民王晓锋雷雨婷
Owner GENETALKS BIO TECH CHANGSHA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com