Interleukin 11 mutant and application thereof in treating hepatic fibrosis

A mutant and human interleukin technology, applied in the field of biomedicine, can solve problems such as the absence of satisfactory drugs, and achieve the effect of inhibiting the activation of signal pathways, inhibiting activation, and broad medicinal prospects

Active Publication Date: 2020-05-08
北京诺赛国际医学研究院
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, although the mechanism of the IL11 signaling pathway has been studied, there are currently no satisfactory drugs targeting the IL11 target.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interleukin 11 mutant and application thereof in treating hepatic fibrosis
  • Interleukin 11 mutant and application thereof in treating hepatic fibrosis
  • Interleukin 11 mutant and application thereof in treating hepatic fibrosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: the construction of interleukin 11 mutant

[0029]pET-21a was selected as the construction vector of IL-11 and its mutants. According to the cDNA sequence of IL-11, the following primers were used for PCR amplification: FP: 5'- CGCGGATCCGACTACAAAGACGATGACGACAAGCCTGGGCCACCACCTGGC-3', the upstream primer was inserted into the BamH I restriction site; RP: 5'-CCGGAATTCTCACAGCC GAGTCTTCAGCAGCAGCAGTCC-3', the downstream primer was inserted EcoR I restriction site. A Flag tag was introduced at the N-terminus during primer design for subsequent protein purification and detection. The amplified IL-11 gene fragment was digested together with the pET-21a plasmid vector, T4 DNA ligase and its Buffer were added to the digested product, and allowed to stand at room temperature for 10 minutes. The ligation product was added to Escherichia coli DH5α competent for heat shock transformation. Put it into a constant temperature shaker to activate the amplification, and the...

Embodiment 2

[0030] Example 2: Expression and purification of interleukin-11 and its mutants

[0031] The interleukin-11 plasmid pET-21a-hIL11 and its mutant plasmids in Example 1 were transformed into Escherichia coli BL21 (DE3) competent, placed in a constant temperature shaker for activation, and then inoculated into LB medium containing ampicillin resistance, After culturing at 37°C for 3 hours, the OD value was kept at 0.4-0.6, and then 1 mM IPTG was added for induction for 4 hours. Collect the thalline, lyse the thalline with the bacterial lysate (50mM HEPES buffer contains 0.1% Triton X-100 and 150ug / ml lysozyme, pH=7.4) for 30min, and the bacterial lysate is ultrasonically broken to a non-viscous state, Then centrifuge at 13,000 rpm for 20 min at 4°C, discard the precipitate, and repeat twice. To concentrate the crude protein, add the supernatant to a saturation of 60% (NH4) 2 SO 4 , to obtain concentrated crude protein. The salt was removed by dialysis with 50 mM HEPES buffer ...

Embodiment 3

[0032] Example 3: Affinity detection of interleukin-11 mutants

[0033] The binding affinity of IL11 obtained in Example 2 and its mutants at 50% effective concentration (EC50) was evaluated by ELISA experiment. 0.8 μg / mL of recombinant human IL11Rα was coated on the Elisa plate, overnight at 4°C, and the sites not bound to IL11Rα were blocked with 2% BSA. IL11 and its mutants were diluted with PBS containing 1% BSA to a concentration gradient of 1000ng / ml, 250ng / ml, 62.5ng / ml, 15.63ng / ml, 3.91ng / ml, 0.98ng / ml. The samples of IL11 and its mutants were sequentially added to the ELISA plate according to the concentration gradient, sealed with a sealing film, and incubated at room temperature for 2 hours. After washing the plate, the detection antibody Flag-HRP was added, sealed with a sealing membrane, and incubated at room temperature for 2 h. Add washing buffer, stay for 1min, discard the liquid, tap dry, repeat 3 times to wash away the unbound detection antibody. Add TMB c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant human interleukin 11 mutant. The amino acid sequence of the recombinant human interleukin 11 mutant is obtained through mutation of three points including N50R,L67K and S145A based on SEQ ID No. 1. The mutant can bind to an IL11R alpha receptor with affinity 40 times or more the affinity of a wild IL11 protein, and can inhibit dimerization activation of gp130; animal experiments prove that the mutant can obviously relieve mouse liver fibrosis; and the mutant can be used for treating non-alcoholic fatty liver diseases, and has wide medicinal prospects.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to an interleukin-11 mutant and its application in treating liver fibrosis. Background technique [0002] Currently, about 25% of people in the world suffer from non-alcoholic fatty liver disease. Although non-alcoholic fatty liver disease can be improved, it will deteriorate into non-alcoholic hepatitis if it is not treated in time [1] . Non-alcoholic hepatitis is characterized by liver inflammation, liver cell death, and liver fibrosis, eventually leading to cirrhosis and liver cancer. The transformation of hepatic stellate cells (HSCs) into myofibroblasts is an important cause of nonalcoholic hepatitis [2-5] . Many factors can activate HSC cells to transform into myofibroblasts, including the pro-fibrotic factors TGFB1, PDGF [6,7] And some pro-inflammatory factors CCL2, TNFA, CCL5, etc. [4,7,8] , but targeting these upstream molecules can cause serious side effects [1,9] . For t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/54A61K38/20A61P1/16
CPCA61K38/00A61P1/16C07K14/5431
Inventor彭菲杨建华
Owner北京诺赛国际医学研究院