Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-EGFR nano antibody and application thereof

A nanobody and expression carrier technology, applied in the fields of medical biology and biopharmaceuticals, can solve the problems of difficult production and purification process, large molecular weight, and high immunogenicity

Active Publication Date: 2020-05-19
FOSHAN CANTON BIOLOGICS CO LTD +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, monoclonal antibodies against EGFR usually have the disadvantages of large molecular weight, difficult production and purification process, and high immunogenicity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-EGFR nano antibody and application thereof
  • Anti-EGFR nano antibody and application thereof
  • Anti-EGFR nano antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Preparation of EGFR-ECD through mammalian expression system 3 Recombinant protein

[0056] (1)pCMV-EGFR-ECD 3 Construction of recombinant plasmid

[0057] Find EGFR-ECD from NCBI 3 Sequence: 5'-ATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCGCAAAGTGTGTAACGGAATAGGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAAAACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCCTTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAAATCACAGGGTTTTTGCTGATTCAGGCTTGGCCTGAAAACAGGACGGACCTCCATGCCTTTGAGAACCTAGAAATCATACGCGGCAGGACCAAGCAACATGGTCAGTTTTCTCTTGCAGTCGTCAGCCTGAACATAACATCCTTGGGATTACGCTCCCTCAAGGAGATAAGTGATGGAGATGTGATAATTTCAGGAAACAAAAATTTGTGCTATGCAAATACAATAAACTGGAAAAAACTGTTTGGGACCTCCGGTCAGAAAACCAAAATTATAAGCAACAGAGGTGAAAACAGCTGCAAGGCCACAGGCCAGCACCACCACCACCACCACTGA-3 '(SEQ ID NO: 2), and sent to the synthesis of pCMV-EGFR-ECD 3 Recombinant plasmid (synthesized by Sangon Biotech).

[0058] (2) 293F cells are transiently transfected to express E...

Embodiment 2

[0069] Example 2 Preparation of Phage Nanobody Library

[0070] Using the purified protein obtained above to prepare a phage nanobody library includes the following steps:

[0071] (1) Utilize the above EGFR-ECD 3 Purified protein to immunize Bactrian camels, and collect immune EGFR-ECD 3 Take 100 mL of blood from each of the Bactrian camels, mix the collected blood with an equal volume of normal saline, slowly add the diluted blood to the surface of the lymphocyte separation solution, and centrifuge at 2000 rpm for 20 minutes at room temperature. Aspirate the lymphocytes of the second layer, add five times the volume of PBS, centrifuge at 2000 rpm at room temperature for 20 minutes, and repeat three times. The collected lymphocytes were added to 1 mL of Trizol (purchased from Invitrogen, catalog number: 15596026) reagent, and the mixture was mixed repeatedly, and centrifuged at 12000 rpm and 4° C. for 15 min. Then add 0.2 mL of chloroform to the supernatant after centrifugation, ...

Embodiment 3

[0091] Example 3 Panning of phage Nanobody library

[0092] The panning of the phage Nanobody library obtained in Example 2 includes the following steps:

[0093] (1) Use NaHCO 3 Coating solution (purchased from Sigma, catalog number s6297) diluted EGFR-ECD 3 Protein, 20μg EGFR-ECD per well 3 The protein was coupled in an enzyme-labeled plate at 4°C overnight, and a negative control was set.

[0094] (2) The next day, suck the uncoupled target protein from the microplate, then add 300μL of 0.1% PBST, let stand for 3min (wash the plate once), then add 2% skimmed milk powder to the microplate, block at 37℃ After 2h, wash the plate once with 300μL 0.1% PBST solution and let it stand for 3min.

[0095] (3) Take 300 μL of the prepared phage nano antibody library and mix it with an equal volume of 2% skimmed milk powder, add 100 μL of the above mixed solution to each well, and incubate at 37°C for 1 hour.

[0096] (8) Add 300 μL of 0.1% PBST solution to each well to wash the plate 5 to 15 ti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Ec50aaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of medical biology and biological pharmacy, and in particular to an anti-EGFR nano antibody and an application thereof. The provided anti-EGFR nano-antibody is at least one selected from the follows: (1) CDR1 shown by GYTGCKNGMS, CDR2 shown by IDRDGSP and CDR3 shown by ATNPQRNIYGGSWCNY; and (2) a material with substitution of at least one conservative amino acid compared with (1). The provided anti-EGFR nano-antibody has a small molecular weight, strong specificity, and strong binding capacity with an EGFR active region CD3, and can be used for diagnosing and treating tumors with high EGFR expression.

Description

Technical field [0001] The invention relates to the technical fields of medical biology and biopharmaceuticals, in particular to an anti-EGFR nano antibody and its application. Background technique [0002] Epidermal Growth Factor Receptor (EGFR, HER1) is a transmembrane glycoprotein, which plays an important role in the physiological processes of cell growth, proliferation and differentiation. EGFR is a promising target for tumor diagnosis and treatment. Studies have shown that growth factor receptors are overexpressed in a variety of solid tumor cells and play an important role in the occurrence and development of cancer. Antibodies that can target EGFR play an important role in the treatment of cancer. [0003] However, monoclonal antibodies directed against EGFR usually have the disadvantages of large molecular weight, difficult production and purification processes, and high immunogenicity. Screening Nanobodies from the Nanobody library can obtain high-affinity Nanobodies i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C12N15/13C12N5/10G01N33/574A61K39/395A61P37/02A61P35/00
CPCA61K2039/505A61P35/00A61P37/02C07K16/2863C07K2317/565C07K2317/569G01N33/574
Inventor 熊盛谢秋玲沈潇韩玥
Owner FOSHAN CANTON BIOLOGICS CO LTD