Rapid full-length amplicon library building method suitable for PacBio platform, universal primer and sequencing method

A universal primer and amplicon library technology, which is applied in the field of universal primers and full-length amplicon sequencing based on the library construction method, can solve the problems of accurate identification and classification of difficult species, achieve cost saving, simplify the construction process, The effect of improving the efficiency of database construction

Pending Publication Date: 2020-07-28
WUHAN FRASERGEN CO LTD
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the limitation of the length of short-segment sequencing on the Illumina platform, it is difficult to accurately ide

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid full-length amplicon library building method suitable for PacBio platform, universal primer and sequencing method
  • Rapid full-length amplicon library building method suitable for PacBio platform, universal primer and sequencing method
  • Rapid full-length amplicon library building method suitable for PacBio platform, universal primer and sequencing method

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0039] Example 1:

[0040] For full-length 18S full-length sequencing, the specific operation process of an embodiment is as follows:

[0041] 1. Amplify the full-length target fragment of each sample

[0042] 1. Artificially synthesized PCR universal primers with barcode tag sequence and universal binding sequence

[0043] A total of 24 PCR primers were synthesized for the full-length 18S DNA samples of 12 fungal samples (derived from distiller's lees fermentation residue), and their DNA sequences are as follows:

[0044] SEQ ID No. 1, NS1F-1-T: gcggccgcatcgctctcatgtctagtagtcatatgcttgtctc

[0045] SEQ ID No. 2, NS1F-2-T: gcggccgcacgatgtatctacgcagtagtcatatgcttgtctc

[0046] SEQ ID No. 3, NS1F-3-T: gcggccgctcgatacgcactcgatgtagtcatatgcttgtctc

[0047] SEQ ID No. 4, NS1F-4-T: gcggccgccacgacacgacgatgtgtagtcatatgcttgtctc

[0048] SEQ ID No. 5, NS1F-5-T: gcggccgcctgcagctcactactagtagtagtcatatgcttgtctc

[0049] SEQ ID No. 6, NS1F-6-T: gcggccgcctatatgagacgagtggtagtcatatgcttgtctc ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a rapid full-length amplicon library building method suitable for a PacBio platform, a universal primer and a full-length amplicon sequencing method based on the library building method. According to the library building method, aiming at the characteristic that full-length amplicon sequencing needs PCR, in combination with a dumbbell type library joint structure of the PacBio sequencing platform, the universal primer with a special structure aiming at a full-length amplicon is designed, and a PCR product with a specific sticky end is obtained through an amplificationreaction, and then sequencing joints with same sticky ends are connected to finish library construction of the PacBio sequencing platform. According to the method, an original PacBio standard libraryconstruction process is optimized to be only one-step amplification and enzyme digestion connection, so that the library construction process of the full-length amplicon is greatly simplified, the working efficiency is improved, and the sequencing cost is reduced.

Description

technical field [0001] The present invention relates to the technical field of high-throughput sequencing library construction, and more specifically, to a method for rapid library construction of full-length amplicons applicable to the PacBio platform, universal primers used, and full-length amplification based on the library construction method sub-sequencing method. Background technique [0002] Amplicon (amplicon) is a nucleotide sequence after DNA or RNA amplification. For example, the amplified fragment of a certain gene obtained by PCR amplification. More simply, the amplicon is the amplification product of a DNA fragment or RNA fragment that has been artificially amplified. Amplicon sequencing is a highly targeted approach for the analysis of genetic variants in specific genomic regions. [0003] Amplicon sequencing mainly includes 16S rDNA sequencing, 18S rDNA sequencing, ITS sequencing and target region amplicon sequencing. 16S / 18S rDNA contains variable regions...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6876C12Q1/6806C40B50/06C12N15/11C12Q1/6869
CPCC12Q1/6876C12Q1/6806C40B50/06C12Q1/6869C12Q2521/301C12Q2535/122
Inventor 方涛
Owner WUHAN FRASERGEN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap