Circular RNA detection method and kit

A detection kit and detection method technology, applied in the field of molecular biology, can solve the problems of difficult design of SjodPrimers, false positives, and inability to accurately match cyclization sites.

Active Publication Date: 2020-10-23
GUANGZHOU GENESEED BIOTECH
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Limited by the circular RNA-specific circularization site sequence, a primer designed by Sjod Primers needs to span 4 to 7 bases across the circularization site. If the spanning bases are too small, mismatch differences may be ignored during PCR and cannot be accurate. Match the circularization site; when there are too many bases spanning, especially more than 10nt, the PCR process may only be dominated by the 3' end sequence. The amplification products are mostly linear gene sequences, which can lead to false positive results
Therefore, in practical applications, the design of SjodPrimers is too difficult to take into account the efficiency and specificity of PCR amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Circular RNA detection method and kit
  • Circular RNA detection method and kit
  • Circular RNA detection method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] The circular RNA hsa_circ_0005836 is detected by qPCR, and the reverse transcription reaction is performed using the HT reverse transcription reagent of the present invention, and a conventional reverse transcription kit is used as a control.

[0073] 1. Primer design and synthesis

[0074] Obtain the circular RNA sequence and the Splice junction sequence from the circBase database, and input the 30bp sequence of the upstream 20bp and the downstream 10bp of the Splicejunction position into the primer design software, respectively design two pairs of primers, send the sequences to Shenggong Biosynthesis, and PAGE purification.

[0075] Divergent Primers:

[0076] 5836-DF:ATCATCAGGGCATCTATGTA

[0077] 5836-DR:ACTCATCCTTGAACCTTGCAG

[0078] Amplification size 122bp

[0079] FSjod Primers:

[0080] 5836-FF2:TTAGAACATGCATCTAAGGT

[0081] 5836-FR2:ATACTGTTTTCCTGCAGACAT

[0082] Amplification size 198bp

[0083] 2. RNA extraction and reverse transcription

[0084] Trizol Reagent was used to ex...

Embodiment 2

[0104] qPCR detects circular RNA hsa_circ_0007874, uses the HT reverse transcription reagent of the present invention to perform reverse transcription reaction, and uses a conventional reverse transcription kit as a control.

[0105] 1. Primer design and synthesis

[0106] Obtain the circular RNA sequence and the Splice junction sequence from the circBase database, and input the 30bp sequence of the upstream 20bp and the downstream 10bp of the Splicejunction position into the primer design software, respectively design two pairs of primers, send the sequences to Shenggong Biosynthesis, and PAGE purification.

[0107] Divergent Primers:

[0108] 7874-DF:GAGCTGTAGAAGATCTTATTC

[0109] 7874-DR:TAATGTACACCAGACTGGTC

[0110] Amplification size 193bp

[0111] FSjod Primers:

[0112] 7874-FF3:TCAGTGGGGTTGTTTTGGGTC

[0113] 7874-FR3: TGAGCTCTCAGACCCCACACA

[0114] Amplification size 184bp

[0115] 2. RNA extraction and reverse transcription

[0116] Same as Example 1.

[0117] 3. qPCR amplification

[0...

Embodiment 3

[0126] The circular RNA hsa_circ_0005836 is detected by qPCR, the HS PCR amplification reagent of the present invention is used for qPCR amplification, and the conventional qPCR amplification kit is used as a control.

[0127] 1. Primer design and synthesis

[0128] Obtain the circular RNA sequence and the Splice junction sequence from the circBase database, enter the 30bp sequence of the upstream 20bp and the downstream 10bp of the Splicejunction position into the primer design software, and design two sets of 1 base and 6 bases across the circularization site. For the FSjod primer, the sequence was sent to Shenggong Biosynthesis and purified by PAGE.

[0129] FSjod Primers:

[0130] 5836-FF1:TTTAGAACATGCATCTAAGG

[0131] 5836-FR1:ACTGTTTTCCTGCAGACATCT

[0132] Amplification size 197bp

[0133] 5836-FF6:GAACATGCATCTAAGGTTTAC

[0134] 5836-FR6: TGAAGTACATAGATGCCCTGA

[0135] Amplification size 150bp

[0136] 2. RNA extraction and reverse transcription

[0137] Same as Example 1.

[0138] 3. q...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology, and relates to a circular RNA detection method and kit. The circular RNA detection method comprises the following steps: S1, primer design; S2,reverse transcription reaction: taking 0.1-1 [mu]g of extracted total RNA, adding N6 Random Primer and RNase-Free H2O, performing mixing to obtain a reaction solution I, adding 5 x HT RT Buffer intothe reaction solution I, adding HT M-MLV Mix into the reaction solution I, and finally adding RNase-Free H2O to obtain cDNA; and S3, HS PCR amplification: performing qPCR detection by using the FSjodPrimers obtained in the step S1, 2 x SNP Taq Mix, 50 x ROX Mix *, the RNase-Free H2O and the cDNA obtained in the step S2.

Description

Technical field [0001] The invention relates to the field of molecular biology, in particular to a circular RNA detection method and a kit. Background technique [0002] Circular RNA (circular RNAs, circular RNAs) is a kind of RNA molecule with a closed circular structure, which is widespread in many species and is more stable than linear RNA. Circular RNA can play an important role in brain development, Parkinson's disease, Alzheimer's disease, and tumorigenesis through miRNA sponge, interact with polymerase II (RNA polymerase II, Pol II) to regulate host transcriptional activity, and directly translate protein. It is expected to be used as a disease diagnostic marker or therapeutic target. Therefore, a reliable quantitative detection method for circular RNA is essential. [0003] At present, the quantitative detection of circular RNA includes RT-PCR, RT-qPCR, Taqman qPCR, ddPCR, and Northernblot. Among them, RT-qPCR is the most widely used and the most convenient and economical...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851
CPCC12Q1/6851C12Q2531/113C12Q2525/307C12Q2521/107C12Q2521/101
Inventor刘明李自强黄宁宁
OwnerGUANGZHOU GENESEED BIOTECH