Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of mandarin fish rhabdovirus glycoprotein expressed by recombinant baculovirus

A technology of recombinant baculovirus and rhabdovirus, applied in the biological field, can solve the problems of host cell toxicity, imperfect processing and modification system, and regulation of expression time and expression level.

Pending Publication Date: 2020-10-30
YANGZHOU UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But at the same time, there are still many insurmountable shortcomings in the prokaryotic expression system: for example, the commonly used expression system cannot regulate the expression time and expression level, the continuous expression of some genes may have toxic effects on the host cells, and overexpression may lead to abnormal Physiological reactions, the target protein is often expressed in the form of inclusion bodies, resulting in difficulties in product purification; and the post-translational processing and modification system of the prokaryotic expression system is imperfect, and the biological activity of the expressed product is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of mandarin fish rhabdovirus glycoprotein expressed by recombinant baculovirus
  • Preparation method of mandarin fish rhabdovirus glycoprotein expressed by recombinant baculovirus
  • Preparation method of mandarin fish rhabdovirus glycoprotein expressed by recombinant baculovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The preparation method of the mandarin fish rhabdovirus glycoprotein expressed by recombinant baculovirus of embodiment 1

[0030] 1. Primer design and synthesis

[0031] Primers were designed based on the published sequence of the SCRV-G gene. The primers were designed after the 5' signal peptide and 3' hydrophobic region of the G gene were removed.

[0032] Upstream primer GF: GGATCCATGTACCCACTGTTTGTTCCGAT (SEQ ID NO: 1),

[0033] Downstream primer GR: GAATTCCTAGTGATGGTGGTGATGATGAGTTCCCACCCACTCA (SEQ ID NO: 2).

[0034] Primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0035] 2. Amplification and purification of the target gene

[0036]The SCRV genome was used as a template, and GF and GR were used as primers to amplify the glycoprotein gene (G gene). The amplification reaction system was referred to the kit manual. The amplification reaction system was: cDNA template × 1 μL, primer GF × 1 μL, primer GR × 1μL, PremixTaq×10μL, ddH 2 O×7μL, tota...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of mandarin fish rhabdovirus glycoprotein expressed by recombinant baculovirus. The preparation method comprises the following steps: designing and synthesizing primers; amplifying and purifying a target gene; constructing a recombinant donor plasmid pFastBac-G; constructing a recombinant shuttle plasmid rBacmid-G; preparing a recombinant baculovirus; purifying the target protein; and carrying out Western blot detection. According to the invention, a large amount of soluble recombinant proteins with good antigenicity and immunogenicity and similar functions to natural proteins can be obtained, and the method is suitable for high-efficiency expression of mandarin fish rhabdovirus glycoproteins and preparation of DNA vaccines.

Description

technical field [0001] The invention relates to a preparation method of mandarin fish rhabdovirus glycoprotein expressed by recombinant baculovirus, belonging to the field of biotechnology. Background technique [0002] Baculovirus expression system (BES) is currently one of the most widely used protein expression systems, commonly used in drug development, vaccines, growth-promoting factors, oncogenes, tumor suppressor gene protein products, and certain oncogenic virus proteins , immune active molecules, gene expression regulation and other fields. Using baculovirus as a carrier can efficiently express foreign genes. Up to now, hundreds of genes including animals, plants, viruses, bacteria, and fungi have been efficiently expressed in insect cells or larvae. The main feature of this expression system is that it can obtain a large number of soluble recombinant proteins with good antigenicity and immunogenicity and similar functions to natural proteins. After the recombinan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/866C07K14/145
CPCC12N15/86C07K14/005C12N2760/20051C12N2710/14043C12N2800/105
Inventor 刘晓丹孙威张晓君曹攀张彦冰
Owner YANGZHOU UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More