pd-l1 binding polypeptides and uses thereof
A technology of PD-L1 and peptide binding, applied in the field of biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0143] Example 1: Screening of heavy chain single domain antibodies against PD-L1
[0144] 1.1 Construction of the library
[0145] The PDL1-Fc fusion protein used for immunization was expressed by CHO cells and purified by Protein A affinity chromatography. A Xinjiang Bactrian camel was selected for immunization. After 4 immunizations, 100 ml of peripheral blood lymphocytes from camels were extracted and total RNA was extracted using the RNA extraction kit provided by QIAGEN, and the extracted RNA was reverse transcribed using the Super-Script III FIRSTSTRANDSUPERMIX kit (Thermo Fisher Scientific) according to the instructions. into cDNA. Amplification of nucleic acid fragments encoding variable regions of heavy chain antibodies by nested PCR:
[0146] The first round of PCR:
[0147] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC (SEQ ID NO: 14);
[0148] Downstream primer: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 15).
[0149] Second round of PCR:
[0150] Using the first roun...
Embodiment 2
[0159] Example 2: Preliminary evaluation and identification of heavy chain single domain antibodies against PD-L1
[0160] 2.1 Construction of gene cloning of PD-L1 single domain antibody
[0161] The amino acid sequence of the single-domain antibody is shown in Table 1, of which 109-chis is a recombinant protein with a His-tagged C-terminal. CDR sequences are shown with boxes.
[0162] Table 1
[0163]
[0164] The nucleotide sequences encoding the single domain antibodies of Table 1 are shown in SEQ ID NO:3 and SEQ ID NO:4.
[0165] Nucleotide sequence of 109 single domain antibody:
[0166] CAGGTGCAGCTGCAGGAGTCTGGAGGAGGCTCGGTGCAGGCTGGGGGGTCTCTGAGACTCTCCTGTACAGCCTCTGGATTCAGTTTAGATGATTCTGACATGGGCTGGTACCGCCAGGCTCGTGGGAATGTGTGCCAGTTGGTGTCAACAATTGCTAGTGATAGAAGTACATACTATACACCCTCCGTGAAGGGCCGATTCACCATCTCCCATGACAGAGCCAAGAACACAATTTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTGTATTACTGTGCGGCAGCCCCTCGCCTGGCCTACACAACGGCGATGACGTGCGAGGGGGACTTTGCTTACTGGGGCCAGGGAACCCAGGTCACCGTCTCCTCATAA(SE...
Embodiment 3
[0175] Example 3: In vitro activity analysis of PD-L1 antibody protein
[0176] 3.1 Competitive ELISA to investigate the blocking effect of PD-L1 heavy chain single domain antibody on the interaction between PD-1 and PD-L1
[0177] PDL1-muFc fusion protein (using murine Fc) and PD1-Fc fusion protein were cloned into pCDNA4 vector (Invitrogen, Cat V86220) and expressed in HEK293 cells. PDL1-muFc fusion protein 0.5μg / well was coated overnight at 4°C, and then 10μg PD1-Fc was added to each well (no antibody or protein was added to the blank group, only an equal volume of buffer was added) and the initial dilution concentration was 3μg / L The heavy chain single domain antibody 109-chis (control group was buffer), 2-fold dilution, 12 gradients, and reacted at room temperature for 1 hour. Then, anti-his-HRP (purchased from Abcam) was added, and the reaction was carried out at room temperature for 1 hour. Then add the color developing solution and read the absorption value at 405nm ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More