Application of microRNA molecule in diagnosis and treatment of lymph node metastasis of T1-stage esophageal squamous cell carcinoma

A technology for lymph node metastasis and esophageal squamous cell carcinoma, applied in the direction of DNA/RNA fragments, medical preparations containing active ingredients, recombinant DNA technology, etc., can solve the problem of difficult treatment plans, excessive radiotherapy, chemotherapy, and inadequate treatment of patients with lymph node metastasis And other issues

Pending Publication Date: 2021-02-26
CANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to the lack of indicators that can accurately predict the lymph node metastasis of T1 esophageal squamous cell carcinoma, it is difficult to choose the treatment plan for patients with this disease, and it is easy to lead to excessive radiotherapy and chemotherapy for patients without lymph node metastasis, or for patients with lymph node metastasis. , or patients with underlying lymph node metastases are inadequately treated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of microRNA molecule in diagnosis and treatment of lymph node metastasis of T1-stage esophageal squamous cell carcinoma
  • Application of microRNA molecule in diagnosis and treatment of lymph node metastasis of T1-stage esophageal squamous cell carcinoma
  • Application of microRNA molecule in diagnosis and treatment of lymph node metastasis of T1-stage esophageal squamous cell carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Embodiment 1: the method for detecting the expression of microRNA-20b gene in paraffin tissue

[0071] 1. Extract paraffin tissue RNA with Qiagen kit

[0072] (1) Sample source

[0073] The tissue samples of T1 esophageal squamous cell carcinoma were obtained from the Cancer Hospital of the Chinese Academy of Medical Sciences. There were enough formalin paraffin-embedded tissues to obtain sufficient microRNA, and there were complete medical written records and follow-up records. They were divided into two groups for microRNA microarray detection to screen microRNAs associated with lymph node metastasis of T1 esophageal squamous cell carcinoma. Another independent formalin-fixed paraffin-embedded tissue of T1 esophageal squamous cell carcinoma was selected to verify the microarray results. RNeasy FFPE Kit (Qiagen, 74404) was used, and the extraction steps were carried out according to the instructions attached to the kit.

[0074] 2. Total RNA quality detection

[00...

Embodiment 2

[0099] Embodiment 2: the method for detecting the expression of microRNA-20b gene in serum

[0100] 1. In vitro transcription and synthesis of mouse non-coding RNA-GM13008

[0101] MEGAscript T7 Transcription Kit (AM1334, Invitrogen) was used, and the in vitro transcription step was performed according to the instructions attached to the kit.

[0102] 2. Extract serum RNA with Qiagen kit

[0103] Serum samples of T1 esophageal squamous cell carcinoma were obtained from the Cancer Hospital of the Chinese Academy of Medical Sciences. There was enough serum to obtain sufficient microRNA, and there were complete medical written records and follow-up records. After mixing 100 ng of mouse-derived non-coding RNA-GM13008 per 100 ul of serum, serum RNA was extracted with QIAamp Circulating Nucleic Acid Kit (Qiagen, 55114), and the extraction steps were performed according to the instructions attached to the kit.

[0104] 3. Total RNA quality detection

[0105] (1) NanoDrop (Gene Com...

Embodiment 3

[0124] Example 3: Study on the biological effects of treating the cell supernatant produced by esophageal cancer cells with microRNA-20b inhibitors to inhibit the tube-forming and migration abilities of human lymphatic endothelial cells

[0125] 1. Experimental steps

[0126] (1) Cell culture

[0127] Human esophageal cancer cell lines: KYSE30 and KYSE450 (gifted by Professor Shimada Y of Kyoto University), RPMI1640 medium (Gibco), containing 10% fetal bovine serum (FBS, Gibco), cultured at 37°C, 5% CO2.

[0128] Human lymphatic endothelial cell line: HDLEC (Shanghai Guyan Biotechnology Co., Ltd.), RPMI1640 medium (Gibco), containing 10% fetal bovine serum (FBS, Gibco), cultured at 37°C, 5% CO2.

[0129] (2) Transient cell transfection

[0130] a. microRNA-20b inhibitor transient transfection

[0131] The sequence of the microRNA-20b inhibitor: 5'CUACCUGCACUAUGAGCACUUUG 3' (SEQ ID NO: 5), synthesized by Invitrogen.

[0132] (1) Preparation of microRNA-20b inhibitor: Add 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an application of a microRNA molecule in diagnosis and treatment of lymph node metastasis of T1-stage esophageal squamous cell carcinoma. Specifically, the invention relates to the application of a detection agent for detecting the expression level of microRNA-20b in predicting and / or diagnosing whether a T1-stage esophageal squamous cell carcinoma patient is accompanied by lymph node metastasis or not, selecting a treatment scheme for the T1-stage esophageal squamous cell carcinoma patient or evaluating the treatment effect on the T1-stage esophageal squamous cell carcinoma patient, and on the other hand, the invention relates to the application of a reagent for inhibiting and / or reducing the expression level of the microRNA-20b in preparation of a medicine for treating the esophageal squamous cell carcinoma.

Description

technical field [0001] The invention relates to the technical field of diagnosis and / or treatment of T1 stage esophageal squamous cell carcinoma lymph node metastasis. It specifically relates to the use of microRNA-20b molecules in the diagnosis and / or treatment of lymph node metastasis of T1 esophageal squamous cell carcinoma. Background technique [0002] Esophageal cancer is one of the common malignant tumors in humans. The majority of esophageal cancer in my country is squamous cell carcinoma, and its morbidity and mortality rank first in the world. With the extensive development of regular physical examination and early cancer screening in areas with high incidence of esophageal cancer, the detection rate of precancerous lesions (Tis stage) and early invasive cancer (T1 stage) has been greatly improved. [0003] According to the eighth edition of the TNM staging criteria for malignant tumors jointly issued by the Union for International Cancer Control (UICC) and the A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6886C12N15/11A61K45/00A61K31/7088A61P35/00
CPCC12Q1/6886A61K45/00A61K31/7088A61P35/00C12Q2600/178C12Q2600/158
Inventor 宋咏梅薛丽燕詹启敏吕宁赵梓彤
Owner CANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap