Application of protein secp43 or its encoding gene in regulating male fertility of Drosophila melanogaster

A technology that encodes genes and male sterility. It is applied in the fields of application, genetic engineering, and plant gene improvement. It can solve the problems that the research on the physiological and molecular functions of RNA-binding proteins needs to be further studied.

Active Publication Date: 2021-07-30
PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still a large number of RNA-binding proteins whose functions are not yet understood
[0003] In recent years, there have been many studies on RNA-binding proteins in animals and plants, but the research on the physiological and molecular functions of RNA-binding proteins remains to be in-depth

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein secp43 or its encoding gene in regulating male fertility of Drosophila melanogaster
  • Application of protein secp43 or its encoding gene in regulating male fertility of Drosophila melanogaster
  • Application of protein secp43 or its encoding gene in regulating male fertility of Drosophila melanogaster

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] 1. The target gene, its nucleotide sequence is as follows:

[0019] atggcgtccgtgcattgtcaactgtggatgggaagcctggagtcctacatgacggagaacttcataatcgccgctttccggaagatgggcgaagatcccaccacggtgcgcctgatgcgcaacaagtacacgggcgaaccggccggctactgcttcgtcaacttcatatccgatgaccatgcgctggacgcgatgcacaagctaaacggtaagcccattccgggcaccaatcccattgtgcgattccgtcttaactcggccagcaactcgtacaagctgcccgggaatgaacgcgaatttagcgtctgggtgggcgacctcagctcggacgtggacgactatcagctgtacaaggtgttctccagcaagttcacatcgatcaaaaccgccaaggtgatcttggacagcctggggttttccaagggttacggctttgtgcgatttggcatcgaggatgagcagaaatcagcgctgtacgacatgaacgggtacatcggattgggtaccaagcccataaagatttgcaatgccgtgcccaaacccaaatccgagttgggtggtgctgtgggcgaaggcaacacaaactatggatatggaagcggtatgactgcagcaggtggcaccgactactcgcagtactacgaccccaccagcacctattggcagggataccaggcctggcaaggttactacgagcaggccggtgcttcgatcacagatgcggctgcatactaccagcaggccatgtcgcagtcgcactctaatccgcagactctggcccagcacgccgaggcctggagcgcacaacgcagcgcccagtacgagcagcagcagcagcagcagaccgcttccgccgccaatggagctgaggatgagaacggactggtggagcacaagttcgtcctggatgtggacaaac...

Embodiment 2

[0062] (1) Primers are designed such that each pair of primers contains the gRNA target site, and the fragment is amplified by PCR. Since the mutation site has a restriction site, only the PCR fragment of one chromosome will be digested smoothly, and the PCR product of the other mutant chromosome will not be digested. As a result, we obtained heterozygous mutants of Secp43, such as figure 1 shown. The results showed that the mutant generation rate was about 10%, and finally the deletion position and the number of missing bases were determined by sequencing.

[0063] (2) Randomly select wild-type Drosophila melanogaster w1118 and Secp43 frameshift mutant Secp43 with the same number of eclosion days L2-6 and Secp43 L5-4 , non-frameshift mutant Secp43 of Secp43 L3-3 and Secp43 L10-2 Each of 30 newly emerged adults (female and male adults) was mated with 3 w1118 individually, and their fertility was counted after 3D. experiment result shows( figure 2 ), the number of offsp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses the application of the protein Secp43 or its coding gene in regulating the male fertility of Drosophila melanogaster. The amino acid sequence of the protein Secp43 is shown in SEQ ID NO.2. The present invention finds that knocking out the coding gene Secp43 can make the Drosophila melanogaster male sterile, the bundled sperm cannot be separated, and the immature sperm cannot enter the seminal vesicle, which may be the main reason for the male infertility. Therefore, the present invention screens out a new protein related to male sterility of Drosophila melanogaster, and in view of the homology of some proteins between Drosophila and humans, it will help us to find a new therapeutic target for infertility. And in-depth research on the regulatory mechanism of Secp43 causing male sterility in Drosophila melanogaster from the perspective of RNA binding proteins will help us find new therapeutic targets for infertility.

Description

Technical field: [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of protein Secp43 or its coding gene in regulating the male fertility of Drosophila melanogaster. Background technique: [0002] In eukaryotes, the post-transcriptional regulation of gene expression is a very complex and critical step. In the RNA metabolic pathway, a large number of protein factors are required to interact, and RNA metabolism is also regulated by a variety of signaling pathways. According to the function and location of RNA, RNA can be divided into many types. Each RNA has a large number of RNA binding proteins interacting with it to stabilize, protect, assemble or transfer it, and also regulate the interaction of RNA with other molecules or catalyze RNA unwinding and replication, etc. The research on RNA-binding proteins has always been valued by relevant biochemists, and many RNA-binding proteins with different structures and functions...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/47C12N15/12C12N15/85C12N15/113A01K67/033
CPCA01K67/0339A01K2217/075A01K2227/706A01K2267/03C07K14/47C12N15/113C12N15/85C12N2310/20
Inventor 陈洁黄元泰齐国君
Owner PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap