Anti-PD-L1 nano antibody as well as derivative and application thereof

A PD-L1 and nanobody technology, applied in the field of biomedicine or biopharmaceuticals, can solve the problems of small molecular weight, lack of nanobody, stable immunogenicity and weak penetrability

Active Publication Date: 2021-03-12
BIOTHEUS INC
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition to the antigen reactivity of monoclonal antibodies, nanobodies also have some unique functional characteristics, such as small molecular weight, strong stability, good solubility, easy expression, weak immunogenicity, strong penetrability, and strong targeting , Humanization is simple, and the preparation cost is low, which almost perfectly overcomes the defects of traditional antibody such as long development cycle, low stability, and harsh storage conditions.
[0007]However, there is still a lack of satisfactory nanobodies against PD-L1 in the art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-PD-L1 nano antibody as well as derivative and application thereof
  • Anti-PD-L1 nano antibody as well as derivative and application thereof
  • Anti-PD-L1 nano antibody as well as derivative and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0192] Example 1: Construction of Nanobody Library

[0193] animal immunity

[0194] Mix 1 mg of human PD-L1 antigen (purchased from AcroBiosystems) with an equal volume of Freund's adjuvant, immunize 2 alpacas (Llama), once a week, and immunize 4 times in total to stimulate B cells to express antigen-specific nanobodies . After the 4 times of immunization, 50ml of alpaca peripheral blood was extracted, and lymphocytes were separated by lymphocyte separation medium. Total RNA was extracted using RNA extraction reagent Trizol (purchased from Invitrogen). Alpaca total cDNA was obtained by reverse transcription using a cDNA synthesis kit (purchased from Invitrogen).

[0195] Nanobody gene amplification

[0196] In the first round of PCR, the IgG2 and IgG3 sequences were amplified from the cDNA:

[0197] Table 1. First-round PCR primers

[0198] name sequence (5' to 3') upstream primer GTCCTGGCTGCTCTTCTACAAGG downstream primer GGTACGTGCTGTTGAACT...

Embodiment 2

[0208] Example 2: Screening of PD-L1 Nanobodies

[0209] Biotinylation of human PD-L1 protein

[0210] Take an appropriate volume of double distilled water to dissolve human PD-L1 protein (purchased from AcroBiosystems), follow the product instructions of the biotin labeling kit (purchased from Thermo), dissolve the biotin and mix it with the protein solution, and incubate at 4°C for 2 hours. A desalting column (purchased from Thermo) was used to remove excess biotin, and the pretreatment of the desalting column and sample collection operations were performed referring to the steps in the product manual.

[0211] MACS enrichment of yeast that specifically binds to PD-L1

[0212] The VHH library constructed in Example 2 was inoculated in SD-CAA expansion medium (6.7g YNB, 5g casamino acids, 13.62g Na 2 HPO 4 12H 2 O, 7.44g NaH 2 PO 4 and 2% glucose), the number of yeast cells inoculated >10× library capacity (initial amplification concentration = 0.5OD 600 / ml), 30°C...

Embodiment 3

[0218] Example 3: Construction, expression and purification of heavy chain antibodies

[0219] Antibody gene construction into pCDNA3.1 expression vector

[0220] The VHH gene sequence was connected to the Fc segment of human IgG1 (LALA mutation), and the linearized pCDNA3.1 vector was digested with homologous recombinase (purchased from Vazyme) and EcoR I / Not I double restriction enzymes, and the procedure was in accordance with the product instructions. Homologous recombination products were transformed into Top10 competent cells, coated with ampicillin-resistant plates, cultured at 37°C overnight, and single clones were picked and sequenced.

[0221] cell transfection

[0222] Using ExpiCHO TMExpression system kit (purchased from Thermo), the plasmid was transferred into Expi-CHO cells, the transfection method was according to the product instructions, and the supernatant was collected after 5 days of cell culture and purified by protein A magnetic beads (purchased fr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an anti-PD-L1 nano antibody as well as a derivative and an application thereof. Specifically, the invention provides an anti-PD-L1 nano antibody, and the antibody has a function of blocking binding of PD-L1 and a receptor PD-1. Moreover, the invention provides a gene sequence for encoding the nano antibody, a corresponding expression vector, a host cell capable of expressing the nano antibody, and a production method of the nano antibody. Meanwhile, the invention also provides a fusion protein with the PD-L1 nano antibody and an immunomodulatory molecule part, which can inhibit a PD-1 / PD-L1 pathway on the basis of targeting and neutralizing TGF-beta of a tumor microenvironment, can restore the activity of T cells, enhances immune response, and more effectively improves the effect of inhibiting tumor generation and development.

Description

technical field [0001] The present invention relates to the technical field of biomedicine or biopharmaceuticals, and more specifically relates to an anti-PD-L1 nanobody and its derivatives and uses. Background technique [0002] Programmed death 1 ligand 1 (programmed death 1 ligand 1, PD-L1), also known as CD274, is a member of the B7 family and a ligand of PD-1. PD-L1 is a type I transmembrane protein with a total of 290 amino acids, including an IgV-like region, an IgC-like region, a transmembrane hydrophobic region and an intracellular region consisting of 30 amino acids. [0003] Unlike other B7 family molecules, PD-L1 negatively regulates the immune response. Studies have found that PD-L1 is mainly expressed in activated T cells, B cells, macrophages and dendritic cells, etc. In addition to lymphocytes, PD-L1 is also expressed in other tissues such as thymus, heart, placenta, etc. Endothelial cells, and various non-lymphoid systems such as melanoma, liver cancer, ga...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/28C12N15/13C07K19/00A61K39/395A61K38/17A61K47/55A61P35/00A61P35/02A61P35/04G01N33/68G01N33/574
CPCC07K16/2827C07K14/71A61P35/00A61P35/02A61P35/04G01N33/68G01N33/57492C07K2317/569C07K2317/565C07K2317/92C07K2317/76C07K2317/94C07K2319/30C07K2319/00A61K2039/505A61K38/00G01N2333/70532A61K47/6849A61K47/6811C07K2317/34C07K2319/33C07K2319/32
Inventor徐祎凤翟天航袁志军曾竣玮孙左宇黄威峰
OwnerBIOTHEUS INC