Multiplex fluorescence PCR kit for detecting prostate cancer

A multiple fluorescence, prostate cancer technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of insufficient sensitivity, time-consuming and cumbersome, and expensive sequencing technology, and achieve sensitivity and specificity. High and low cost effect

A multiple fluorescence, prostate cancer technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of insufficient sensitivity, time-consuming and cumbersome, and expensive sequencing technology, and achieve sensitivity and specificity. High and low cost effect

CN112522404AActive Publication Date: 2021-03-19珠海中科先进技术研究院有限公司

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex fluorescence PCR kit for detecting prostate cancer
  • Multiplex fluorescence PCR kit for detecting prostate cancer
  • Multiplex fluorescence PCR kit for detecting prostate cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 Detection of multiple fluorescent PCR primer sets and probe sets for prostate cancer

[0018] TMPRSS2-ERG, TMPRSS2-ETV1 and TMPRSS2-ETV4 are three highly specific and common fusion genes in prostate cancer, which can be used as a combination of markers to detect prostate cancer. For this marker combination, the inventors designed a multiplex fluorescent PCR primer set and probe set that can quickly detect this marker combination, the primer set includes TMPRSS2-F1, TMPRSS2-F2, ERG-R, ETV1-R and ETV4-R , its nucleotide sequence is shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 respectively, TMPRSS2-ERG, TMPRSS2-ETV1 and TMPRSS2- The upstream primers of the three fusion genes of ETV4 are TMPRSS2-F1 and / or TMPRSS2-F2, and the downstream primers are ERG-R, ETV1-R and ETV4-R respectively. The specific sequences are shown in Table 1 below:

[0019] Table 1 Multiplex fluorescent PCR primer set and probe set for detection of prostate canc...

Embodiment 2

[0022] Embodiment 2 is used for detecting the multiplex fluorescent PCR kit of prostate cancer

[0023] The multiplex fluorescent PCR kit for detecting prostate cancer includes the multiplex fluorescent PCR primer set and probe set for detecting prostate cancer provided in Example 1.

[0024] In a preferred embodiment, it also includes a primer pair and a fluorescent probe for detecting the internal reference gene PSA, the primer pair for the detection internal reference gene PSA is IC-PSA-F and IC-PSA-R, and its nucleotide sequences are respectively As shown in SEQ ID NO:9 and SEQ ID NO:10, the fluorescent probe for detecting the internal reference gene PSA is IC-PSA-P, and its nucleotide sequence is shown in SEQ ID NO:11.

[0025] SEQ ID NO:9cgagaagcattcccaaccc

[0026] SEQ ID NO:10tgccgacccagcaagat

[0027] SEQ ID NO:11gcccactgcatcaggaacaa

[0028] In a preferred embodiment, the 5' end of the fluorescent probe IC-PSA-P is labeled with a fluorescent reporter group Cy5, an...

Embodiment 4

[0047] Example 4 Use the kit of the invention to detect prostate cancer

[0048] In this embodiment, a total of 108 samples to be tested were obtained. According to the results of pathological biopsy, 43 cases of prostate cancer patients were diagnosed, 15 cases of benign prostatic hyperplasia patients, and 50 cases of non-cancerous normal people. Each sample was detected using the kit in Example 2 and the method in Example 3, and the results are shown in Table 3 below. The sensitivity of using the kit of this patent to detect prostate cancer was 69.7% (30 / 40), and the specificity The sex ratio was 96.9% (63 / 65), the positive predictive value was 93.8% (30 / 32), and the negative predictive value was 72.4% (63 / 87).

[0049] Table 3 Comparison of pathological biopsy results and multiple fluorescent PCR detection results of 108 samples

[0050]

[0051]

[0052] Among the 32 positive samples detected by this patent, the types of fusion genes are shown in Table 4 below. Of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a multiplex fluorescence PCR kit for detecting prostate cancer. The multiplex fluorescence PCR kit comprises a primer group and fluorescence probes, wherein the primer group is used for amplifying three fusion genes TMPRSS2-ERG, TMPRSS2-ETV1 and TMPRSS2-ETV4, and the fluorescence probes correspond to the three fusion genes respectively; the primer group comprises five primers with the nucleotide sequences as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 respectively; and a probe group comprises three fluorescent probes with the nucleotidesequences as shown as SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 respectively. The kit used for detecting the prostate cancer is simple, efficient, relatively high in accuracy, sensitivity and specificity and low in cost.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a multiple fluorescent PCR kit for detecting prostate cancer. Background technique [0002] Prostate cancer (PCa) patients are mainly elderly men, accounting for the second highest incidence of malignant tumors and the sixth highest mortality rate in the world. With the aging population in our country, the incidence of PCa is increasing year by year, becoming a public problem that threatens the health of men in our country. The most effective treatment for prostate cancer is radical surgery, but PCa has no typical clinical manifestations in the early stage. Once the capsule breaks through, the chance of radical surgery will be lost, and the survival time of patients will be greatly reduced. Therefore, early diagnosis of PCa is to improve the level of diagnosis and treatment and reduce death. key to rate. [0003] At present, digital rectal examination combined with serum...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
19 Mar 2021
Publication
CN112522404A
IPC
C12Q1/6886; C12Q1/6858; C12N15/11
CPC
C12Q1/6886; C12Q1/6858; C12Q2600/156; C12Q2531/113; C12Q2537/143; C12Q2563/107; Y02A50/30
Inventors
谢桦函; 李志鹏