Check patentability & draft patents in minutes with Patsnap Eureka AI!

Colloidal gold test strip for rapidly detecting oyster herpes virus OsHV-1 and application of colloidal gold test strip

A technology of oyster herpes virus and colloidal gold test paper, applied in biological testing, antiviral immunoglobulin, immunoassay and other directions, can solve the problems of inability to realize rapid on-site detection, complicated nucleic acid sample preparation process, and high requirements for operation level, and achieves broad Market application scenarios, easy to carry and save, high sensitivity

Active Publication Date: 2021-04-30
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the existing detection method based on nucleic acid level has high sensitivity, the false positive rate is also high, and the operation level is high, requiring at least constant temperature water bath or metal bath equipment, the detection cycle is long, and the existing methods cannot realize rapid on-site detection Purpose, even if the constant temperature amplification method based on LAMP to be developed in the later stage, there are also problems such as high false positive rate and tedious nucleic acid sample preparation process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Colloidal gold test strip for rapidly detecting oyster herpes virus OsHV-1 and application of colloidal gold test strip
  • Colloidal gold test strip for rapidly detecting oyster herpes virus OsHV-1 and application of colloidal gold test strip
  • Colloidal gold test strip for rapidly detecting oyster herpes virus OsHV-1 and application of colloidal gold test strip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: Preparation of OsHV-1 rapid detection test strip

[0036] 1. Prokaryotic expression and purification of p21 and p25 proteins

[0037] 1) According to the France 2013 strain sequence published by GenBank (GenBank: NC_005881.2), using the pUC57 plasmid as a framework, Shanghai Sangon Bioengineering Co., Ltd. synthesized recombinant vectors containing OsHV-1 p21 and p25 genes, and named them respectively is pUC57-p21, pUC57-p25;

[0038] 2) Using the above-mentioned synthetic recombinant vectors pUC57-p21 and pUC57-p25 as templates, design primer pairs containing multiple cloning sites to amplify genes p21 and p25 according to the template gene sequence. The specific primer pairs are as follows:

[0039] P21:

[0040] p21F 5'GGATCCATGACTTTAGCTGCTAAGTT3' (SEQ ID NO. 3)

[0041] p21R 5'GCGGCCGCACTAATGTAAATATACCCTTC3' (SEQ ID NO. 4)

[0042] P25:

[0043] p25F 5'GAATTCATGGCAACAGACCAACAAGA3' (SEQ ID NO.5)

[0044] p21R 5'GCGGCCGCATTACTTAAAGAGGTCTTCAT3' (SEQ...

Embodiment 2

[0068] Example 2: Detection of OsHV-1 using OsHV-1 rapid detection test strips

[0069] 1. Preparation of Assay Sample Solution

[0070] The shellfish mantle tissue to be tested is collected, and an appropriate amount of tissue lysate is added for grinding and crushing.

[0071] 2. Sample testing

[0072] Drop the sample solution to be tested onto the sample pad of the test strip, and place it horizontally for 3-5 minutes to observe the results.

[0073] 3. Judgment of test results

[0074] Two brown-red bands appear on the test strip test pad (that is, both the test line and the quality control line are colored), indicating that the sample to be tested contains OsHV-1 antigen; only one brown-red band (quality control line) appears as Negative means that no OsHV-1 p21 protein or p25 protein was detected in the sample to be tested; no bands appeared on the test strip, indicating improper detection operation or failure of the test strip.

[0075] Yellow Sea Fisheries Resear...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a colloidal gold test strip method for rapidly detecting oyster herpes virus (OsHV-1) and application of the colloidal gold test strip method. The colloidal gold test strip takes OsHV-1 membrane molecular protein p21 as shown in SEQ ID NO.1 and p25 as shown in SEQ ID NO.2 as antigen molecules to be detected. The rapid detection test strip is strong in specificity and high in sensitivity, and a sample to be detected is simple to prepare. The colloidal gold test paper disclosed by the invention is low in cost, free of complex matched reagents and free of additional configuration equipment; and professionals or non-professionals can operate the device for a short time. The rapid detection test strip is convenient to carry and store, short in detection time, suitable for rapid OsHV-1 diagnosis on site, capable of meeting the requirements of front-line farmers for OsHV-1 diagnosis and wide in market application prospect.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a colloidal gold test strip method for rapidly detecting Ostreidherpesvirus 1 (OsHV-1) and an application thereof. Background technique [0002] In the virus classification report released by the International Committee on Taxonomy of Viruses (ICTV) in 2014, the herpes virus-like particles found in bivalve oysters were officially named Ostreid Herpesvirus 1, OsHV-1 ), belongs to Herpesvirales (Herpesvirales), mollusk Herpesviridae (Malacoherpesviridae). The large-scale death of farmed scallops in Shandong in my country in the 1870s was directly related to this type of virus infection. According to the report of the French Marine Development Research Institute, in 2008, the oyster farming industry in France encountered a devastating crisis due to OsHV-1 infection. French scientists Quikun and Mita led a team to clarify that the summer oyster mortality syn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/558G01N33/58C07K16/08C07K16/06
CPCG01N33/56994G01N33/558G01N33/587C07K16/085C07K16/065G01N2469/10
Inventor 辛鲁生于江南白昌明王崇明
Owner YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More