Detection method and kit for colorectal cancer gene mutation sites
A technology for detection kits and detection methods, which is applied in the biological field and can solve problems such as reduced sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1. A detection method and kit for colorectal cancer gene mutation sites
[0032] This embodiment mainly describes a detection method and kit for a colorectal cancer gene mutation site, and the detection method includes the following detection process:
[0033] Enrolled cases: The inventor conducted a study on patients with colorectal cancer who were treated in the Anorectal Surgery Department of Shanghai Zhongshan Hospital from January 2017 to December 2017. According to CT and blood colorectal cancer tumor indicators (including KRAS, NRAS, PIK3CA, BRAF) examination As a result, neither could determine whether it was colorectal cancer or a benign disease of the colorectum. All patients chose to receive surgical treatment, and 10ml of peripheral venous blood was collected before the operation. According to the postoperative pathological results of the tumor, the samples were divided into colorectal cancer or benign colorectal disease.
[0034] Research method: d...
Embodiment 2
[0085] Example 2. A detection method and kit for colorectal cancer gene mutation sites
[0086]This example mainly describes a detection method and kit for a colorectal cancer gene mutation site. The difference from Example 1 is that for the primer-linked nucleotide sequence "ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT" shown in Tables 1 to 4, shown in SEQ ID NO.561)", to obtain the connected nucleotide sequence, and pretreat the connected nucleotide sequence, the specific method is: add the connected nucleotide sequence to buffer B1 and heat Heat at 70°C for 10 minutes, then cool to 20°C and hold for 20 minutes to obtain the full length of the nucleotide sequence used for detection; the components of buffer B1 are: 290mM NaC1, 4mM MgC1 2 , 18mM Tris (pH 7.6).
[0087] Using the method described in this example, the inventor has completed the detection of 108 clinical blood samples (each case h...
Embodiment 3
[0088] Example 3. A detection method and kit for colorectal cancer gene mutation sites
[0089] This example mainly describes a detection method and kit for a colorectal cancer gene mutation site. The difference from Example 1 is that for the primer-linked nucleotide sequence "ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT" shown in Tables 1 to 4, shown in SEQ ID NO.561)", to obtain the connected nucleotide sequence, and pretreat the connected nucleotide sequence, the specific method is: add the connected nucleotide sequence to buffer B1 and heat Heat at 85°C for 7 minutes, then cool to 40°C and hold for 30 minutes to obtain the full-length nucleotide sequence for detection; the components of buffer B1 are: 310mM NaC1, 6mM MgC1 2 , 22mM Tris (pH 7.6).
[0090] Using the above method, the inventor has completed the detection of 108 clinical blood samples (each case has been tested by NGS), of which...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap