Supercharge Your Innovation With Domain-Expert AI Agents!

Detection method and kit for colorectal cancer gene mutation sites

A technology for detection kits and detection methods, which is applied in the biological field and can solve problems such as reduced sensitivity

Pending Publication Date: 2021-06-04
NANJING PREGENE BIOTECHNOLOGY CO LTD
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to solve the problems existing in the prior art, the present invention provides a method for detecting mutation sites of colorectal cancer genes and its kit, and adopts a unique ultra-multiplex digital PCR technology to greatly improve the information throughput of tumor gene detection. Up to 140 multiple sites can be amplified in at least 4 reaction systems, avoiding the problem of reduced sensitivity caused by sample tube separation, and the increase in the number of detection sites greatly improves the clinical significance of detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and kit for colorectal cancer gene mutation sites
  • Detection method and kit for colorectal cancer gene mutation sites
  • Detection method and kit for colorectal cancer gene mutation sites

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1. A detection method and kit for colorectal cancer gene mutation sites

[0032] This embodiment mainly describes a detection method and kit for a colorectal cancer gene mutation site, and the detection method includes the following detection process:

[0033] Enrolled cases: The inventor conducted a study on patients with colorectal cancer who were treated in the Anorectal Surgery Department of Shanghai Zhongshan Hospital from January 2017 to December 2017. According to CT and blood colorectal cancer tumor indicators (including KRAS, NRAS, PIK3CA, BRAF) examination As a result, neither could determine whether it was colorectal cancer or a benign disease of the colorectum. All patients chose to receive surgical treatment, and 10ml of peripheral venous blood was collected before the operation. According to the postoperative pathological results of the tumor, the samples were divided into colorectal cancer or benign colorectal disease.

[0034] Research method: d...

Embodiment 2

[0085] Example 2. A detection method and kit for colorectal cancer gene mutation sites

[0086]This example mainly describes a detection method and kit for a colorectal cancer gene mutation site. The difference from Example 1 is that for the primer-linked nucleotide sequence "ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT" shown in Tables 1 to 4, shown in SEQ ID NO.561)", to obtain the connected nucleotide sequence, and pretreat the connected nucleotide sequence, the specific method is: add the connected nucleotide sequence to buffer B1 and heat Heat at 70°C for 10 minutes, then cool to 20°C and hold for 20 minutes to obtain the full length of the nucleotide sequence used for detection; the components of buffer B1 are: 290mM NaC1, 4mM MgC1 2 , 18mM Tris (pH 7.6).

[0087] Using the method described in this example, the inventor has completed the detection of 108 clinical blood samples (each case h...

Embodiment 3

[0088] Example 3. A detection method and kit for colorectal cancer gene mutation sites

[0089] This example mainly describes a detection method and kit for a colorectal cancer gene mutation site. The difference from Example 1 is that for the primer-linked nucleotide sequence "ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT" shown in Tables 1 to 4, shown in SEQ ID NO.561)", to obtain the connected nucleotide sequence, and pretreat the connected nucleotide sequence, the specific method is: add the connected nucleotide sequence to buffer B1 and heat Heat at 85°C for 7 minutes, then cool to 40°C and hold for 30 minutes to obtain the full-length nucleotide sequence for detection; the components of buffer B1 are: 310mM NaC1, 6mM MgC1 2 , 22mM Tris (pH 7.6).

[0090] Using the above method, the inventor has completed the detection of 108 clinical blood samples (each case has been tested by NGS), of which...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method and kit for colorectal cancer gene mutation sites. The detection method comprises the following steps: firstly, preparing a digital PCR mixed solution, wherein the digital PCR mixed solution does not contain cytosine triphosphate deoxynucleotide, and a primer used in digital PCR contains a three-dimensional structure and comprises a nucleotide sequence N of not less than 12 basic groups; secondly, performing a PCR amplification reaction by using the digital PCR mixed solution to obtain a product after the PCR amplification reaction; and finally, according to the type of fluorescence signals, judging whether a to-be-detected sample contains a DNA template of the site mutation of a target gene, and the quantity and mutation wind of the to-be-detected sample. The unique ultra-multiplex digital PCR technology greatly improves the information flux of tumor gene detection, as many as 140 heavy sites can be amplified in four reaction systems, the problem that the sensitivity is reduced due to sample branching is avoided, and meanwhile, the clinical significance of detection is greatly improved due to the increase of the number of detection sites.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for detecting colorectal cancer gene mutation sites and a kit thereof. Background technique [0002] As signaling molecules downstream of EGFR, KRAS, NRAS, PIK3CA, and BRAF are key activators in many signaling pathways. Mutations of these genes are common in various malignant tumors, and the mutation rates in colorectal cancer patients are 20-50%, 1-6%, 10-30%, and 8-15%, respectively. Mutations in KRAS, NRAS, PIK3CA, and BRAF genes generally lead to resistance to anti-EGFR antibody drugs in colorectal cancer patients. Therefore, the detection of these gene mutations can help patients choose effective clinical treatment options. Compared with next-generation sequencing technology, PCR technology has the advantages of rapidity, low cost, and simplicity. However, traditional PCR techniques are prone to non-specific amplification. In order to avoid the impact of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6851
CPCC12Q1/6886C12Q1/6851C12Q2600/156C12Q2600/16C12Q2531/113C12Q2563/159C12Q2537/143C12Q2563/107
Inventor 尚午张毅良曹跃鹏
Owner NANJING PREGENE BIOTECHNOLOGY CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More