Methods of treating cytokine release syndrome

A technology of cytokines and syndromes, applied in drug combinations, pharmaceutical formulas, active ingredients of heterocyclic compounds, etc., can solve problems such as serious side effects

Pending Publication Date: 2021-06-25
THE GENERAL HOSPITAL CORP +1
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, sometimes the side effects are severe and require extensive emergency treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods of treating cytokine release syndrome
  • Methods of treating cytokine release syndrome
  • Methods of treating cytokine release syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0160] Example 1. Cromolyn treatment reduces the levels of pro-inflammatory cytokines in plasma of TgSOD1 mice

[0161] Chemicals

[0162] Sodium cromolyn was supplied by AZTherapies, dissolved in PBS. A 100 mM solution was used for in vivo experiments. Dulbecco's PBS was used to dilute the solution for intraperitoneal injection with a final dose of 6.3 mg / kg.

[0163] animal

[0164] 149 age- and litter-matched transgenic TgSOD1 males and females were used G93A and wild-type WtSOD1 G93A Mice, divided into the following groups: female (19WtSOD1-vehicle, 17WtSOD1-cromoglycate, 19TgSOD1-vehicle, and 17TgSOD1-cromoglycate) and male (18WtSOD1-vehicle, 21WtSOD1-cromoglycate, 21TgSOD1-vehicle, 17TgSOD1-cromoglycate). Mice received injections of vehicle or sodium cromolyn (6.3 mg / kg, 96 i.p.) once a day, 5 days a week from P60 until euthanasia.

[0165] All animal care, husbandry, and experiments were performed in accordance with guidelines established by the Massachusetts G...

Embodiment 2

[0176] Example 2. Cromoglycate can reverse pro-inflammatory CD33-mediated activation of M1 microglial cells in APP / PS1 mice segment suppression.

[0177] operate

[0178]Naive BV2 microglia were treated with DMSO (control) or cromolyn (500 μΜ) for 16 hours. Cells were then incubated with fluorescently labeled A1342 (red) and DMSO or cromolyn for 2 hours. After incubation, cells were labeled with a plasma membrane dye (PM, green) and imaged. BV2 microglia or BV2 cells stably expressing CD33 (BV2-CD33wT) were treated with DMSO or different concentrations of cromolyn for 16 hours. Cells were then incubated with soluble unlabeled Aβ42 and DMSO or cromolyn for 2 hours and harvested for ELISA analysis. Naive BV2 and BV2-CD33WT microglia cells treated with cromolyn showed increased levels of Aβ42 uptake compared to cells treated with vehicle (DMSO).

[0179] result

[0180] Interaction of microglia with fibrillar amyloidpeptide (Aβ) results in its phenotypic activation an...

Embodiment 3

[0184] Example 3. Gene expression of IL-1β and IL-6 in N9 microglial cell line stimulated with LPS and treated with cromolyn Da.

[0185] N9 microglial cells were pretreated with different concentrations of cromolyn (15 μg / ml, 30 μg / ml and 60 μg / ml) for 6 hours, and then treated with 500 ng / ml lipopolysaccharide (LPS, the most commonly used microglia) in the presence of cromolyn. cell pro-inflammatory stimulator) stimulation for 8 hours. Cells were harvested and RNA was isolated using TRIZOL (Invitrogen), and first strand cDNA was synthesized using 2 μg of RNA and high capacity reverse transcriptase (Invitrogen). RT-PCR was performed on a Bio-Rad detection system using SYBR Green PCR reagents. RNA levels were normalized to GAPDH levels and calculated as delta-delta threshold cycles (ΔΔCT). Primers used for RT-PCR are listed below: GAPDH-For: AGCCACATCGCTCAGACAC, GAPDH-Rev: GCCCAATACGACCAAATCC; IL-1β-For: CGCTCAGGGTCACAAGAAAC, IL-1β-Rev: GAGGCAAGGAGGAAAACACA; IL-6-For: TT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present disclosure relates to a method of treating at least one condition selected from Cytokine Release Syndrome (CRS), Immune effector Cell-Associated Neurotoxicity Syndrome (ICANS), cancer-related cognitive impairment, Infusion Reaction Syndrome (IRS), Capillary Leak Syndrome (CLS), Tumor Lysis Syndrome (TLS), Macrophage Activation Syndrome (MAS), Systemic Inflammatory Response Syndrome (SIRS), Immune Reconstitution Inflammatory Syndrome (IRIS), Graft-Versus-Host Disease (GVHD), Acute Respiratory Distress Syndrome (ARDS), sepsis, Ebola, avian influenza, smallpox, Systemic Inflammatory Response Syndrome (SIRS), and Immune-related Adverse Events Syndrome (IrAES) in a subject in need thereof, comprising administering a mast cell stabilizer or a compound of Formula I or Formula II shown in the specification, wherein R1 is halogen, OH, or -OC(O)C1-5alkyl, R2 and R3 are each independently selected from CO2R4 or CH2OR5; R4 is Li, Na, K, H, C1-5alkyl, or -CH2CO(C1-5alkyl); and R5 is H or -C(O)(C1-5alkyl), or a pharmaceutically acceptable salt thereof.

Description

[0001] Cross References to Related Applications [0002] This application claims priority to U.S. Provisional Application No. 62 / 727,177, filed September 5, 2018, the entire contents of which are incorporated herein by reference. Background technique [0003] Immune-based biologics are targeted therapies that are impacting the treatment of cancer and other diseases. These therapies are more effective than chemotherapy for several tumor types, as well as for autoimmune and inflammatory diseases. In most cases, however, these therapies are associated with complex, toxicity-related side effects known as drug-related adverse events (DRAEs). These treatments induce a systemic response that activates or suppresses cellular messaging signals, resulting in immunosuppression, cellular hyperactivity, and cellular destruction. These side effects or syndromes have been referred to by different clinical names such as: cytokine release syndrome (CRS), immune effector cell-associated neuro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K31/352C07D311/24
CPCA61K31/352A61K45/06A61P11/00A61P25/28A61P31/16C07D311/24A61K31/4535A61K31/4741A61K31/335A61K31/55A61K31/045A61K31/122A61K31/13A61K31/19A61K31/135A61K2300/00A61K31/573A61K39/395A61K9/0019A61P37/06A61K38/1709
InventorD·R·埃尔马列R·E·坦兹A·戈力西由克R·沃伦K·里夫斯
OwnerTHE GENERAL HOSPITAL CORP