Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A library construction method for pacbio sequencing

A technology of sequencing library and construction method, applied in the field of library construction of PacBio sequencing, can solve the problems of loss of DNA samples, ineffective application, increased time consumption of sequencing libraries, etc., to improve the utilization rate and avoid the lower and lower circularization efficiency. Effect of total DNA requirement

Active Publication Date: 2022-05-17
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the purification and recovery operation not only causes the loss of DNA samples, but also significantly increases the time consumption of sequencing library construction.
These deficiencies prevent the conventional PacBio sequencing library construction method from being effectively applied to occasions where a small amount of DNA is input, such as precious human samples, small animal and plant samples, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A library construction method for pacbio sequencing
  • A library construction method for pacbio sequencing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1. Establishment of the PacBio sequencing library construction method based on Tn5 transposase

[0045] 1. Preparation of transposase complexes containing hairpin sequencing adapters ( figure 1 A)

[0046] 1. Design and synthesis of hairpin sequencing linker sequences

[0047] The sequence of the hairpin sequencing adapter is composed of fragment a, fragment b and fragment c sequentially from the 5' end ( figure 2 ), wherein fragment a and fragment c are completely reverse complementary.

[0048] Fragment a includes a transposase recognition sequence, and fragment a is phosphorylated from the first base at the 5' end;

[0049] In fragment a, a DNA barcode sequence for distinguishing different samples can also be introduced, and the DNA barcode is located at the 3' end of the transposase recognition sequence; the DNA barcode sequence is composed of more than 2 random bases, and the random bases are Any of ATCG;

[0050] Multiple samples correspond to multip...

Embodiment 2

[0070] Example 2, PacBio sequencing library construction based on constant (1 μg) DNA input of Tn5 transposase

[0071] 1. Preparation of the transposase complex PC0 containing the hairpin sequencing adapter ( figure 1 A)

[0072] 1. Design and synthesis of hairpin sequencing linker sequences

[0073] The artificially synthesized hairpin structure sequencing linker sequence PC0 is as follows:

[0074] PC0:

[0075] 5'-pCTGTCTCTTATACACATCT ATCTCTCTC TTTTCCTCCTCCTCCGTTGTTGTTGTT GAGAGAGAT AGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1)

[0076] Among them, the 19 bases in bold at the 5' end ( figure 2 , Fragment a) can form a hairpin structure in a reverse complementary manner with the 19 bases (fragment c) that are thickened at the end of the 3' end; 19 bases at the end of the 5' end (fragment a), and 19 bases at the end of the 3' end The reverse complementary sequence of the base (fragment c) is the Tn5 transposase recognition sequence; the middle 45 base sequence (fragment b) ...

Embodiment 3

[0137] Example 3, PacBio sequencing library construction based on a small amount of (100ng) DNA input from Tn5 transposase

[0138] 1. Preparation of the transposase complex PC0 containing the hairpin sequencing adapter ( figure 1 A)

[0139] 1. Design and synthesis of hairpin sequencing linker sequences

[0140] The artificially synthesized hairpin structure sequencing linker sequence PC0 is as follows:

[0141] PC0:

[0142] 5'-pCTGTCTCTTATACACATCT ATCTCTCTC TTTTCCTCCTCCTCCGTTGTTGTTGTT GAGAGAGAT AGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1)

[0143] Among them, the 19 bases in bold at the 5' end ( figure 2 , Fragment a) can form a hairpin structure in a reverse complementary manner with the 19 bases (fragment c) that are thickened at the end of the 3' end; 19 bases at the end of the 5' end (fragment a), and 19 bases at the end of the 3' end The reverse complementary sequence of the base (fragment c) is the Tn5 transposase recognition sequence; the middle 45 base sequence (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a library construction method for PacBio sequencing. The invention provides a method for constructing a PacBio sequencing library, which is to insert a sequencing linker containing a hairpin structure into a target DNA molecule through a transposase to realize DNA circularization and obtain a PacBio sequencing library. The experiment of the present invention proves that the PacBio sequencing library construction method of the present invention, by effectively selecting the reaction buffer, enables the entire reaction to be completed in the same reaction tube from transposition insertion fragmentation to library circularization, especially when the amount of DNA is low During the construction of the sequencing library, the DNA sample loss caused by the purification and recovery after the conventional fragmentation step is effectively avoided, the utilization rate of the template is improved, the complexity and time consumption of the experiment are reduced, and the completion can be completed within 2 hours at the fastest Construction and recovery of PacBio sequencing library.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a library construction method for PacBio sequencing. Background technique [0002] Third-generation sequencing technologies such as PacBio have promoted the rapid development of genome assembly and structural variation identification. PacBio sequencing requires the use of a circularized DNA library. The existing library construction schemes are based on DNA blunt ends or TA ligation; before library construction, these two ligation methods often require fragmentation of long fragments of DNA and re- After purification and recovery, the sequencing adapters were ligated. However, the purification and recovery operation not only causes the loss of DNA samples, but also significantly increases the time consumption of sequencing library construction. These deficiencies prevent the conventional PacBio sequencing library construction method from being effectively applied to rare human sample...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6806C12N15/10C40B50/06
CPCC12Q1/6806C12N15/1093C40B50/06C12Q2525/191C12Q2525/301C12Q2535/122C12Q2521/501
Inventor 张勇贾行星谭生军蔡英傲张雅琼
Owner INST OF ZOOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com