Polynucleotides having promoter activity and applications thereof in production of amino acids
A polynucleotide and promoter technology, applied in the fields of molecular biology and bioengineering, can solve problems such as complex transformation process, inability to stably and efficiently produce L-lysine, poor genome stability, etc., and achieve improved promoter activity and stable High-efficiency expression and the effect of improving expression strength
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0113] Embodiment 1. Construction of Corynebacterium glutamicum ddh gene promoter strength characterization plasmid
[0114] In order to characterize the strength of the ddh gene promoter of Corynebacterium glutamicum, this example first constructs a characterization vector, connects the ddh gene promoter and the ddh gene fragment to the pEC-XK99E plasmid backbone, and uses the ddh gene promoter to express the ddh gene , connecting peptide and red fluorescent protein (rfp) gene. details as follows:
[0115] (1) According to the published genome sequence and ddh gene annotation information of Corynebacterium glutamicum ATCC13032 (Corynebacterium glutamicum ATCC13032, Gene ID: 2830649), primers ddh-F and ddh-R were designed, and ATCC13032 genome was used as a template to amplify by PCR. The ddh gene promoter and the ddh gene fragment are amplified, and the nucleotide sequence of the amplified fragment is shown in SEQ ID NO:34.
[0116] (2) Using the pEC-XK99E-rfp plasmid as a ...
Embodiment 2
[0122] Embodiment 2. Corynebacterium glutamicum ddh gene promoter mutant screening and intensity characterization
[0123] (1) Construction of Corynebacterium glutamicum ddh gene promoter mutant library
[0124] This embodiment is for the core region "TGATGAAAGAGATGTCCCTGAA" of the ddh gene promoter of Corynebacterium glutamicum TC ATCA TCTAAGTATGCATCTCGG TAAGCT CGACCAGG" is mutated, and the underlined parts are the main sequences of the -35 region and -10 region of the promoter respectively. In this embodiment, the mutation "TGATGAAAGAGATGTCCCTGAA is carried out at the corresponding position of the above core region TCATCA TCTAAGTNNNNNNNNGG TAAGCT CGACCAGG", use ddh-M1, ddh-M2 and ddh-M3, ddh-M4 primers to amplify the two fragments of the plasmid respectively, and use Novizym's one-step recombination kit to clone and connect all the obtained clones. Extract plasmid, obtain ddh gene promoter mutant library.In order to compare the disclosed ddh promoter mutant in the p...
Embodiment 3
[0132] Embodiment 3. Corynebacterium glutamicum ddh gene promoter mutant is applied to lysine production
[0133] (1) Recombinant vector construction of Corynebacterium glutamicum ddh gene promoter mutant
[0134] According to the reported genome sequence of Corynebacterium glutamicum ATCC13032, using the ATCC13032 genome as a template, ddh-UF / ddh-UR and ddh-DF1 / ddh-DR, ddh-UF / ddh-UR and ddh-DF10 / ddh -DR, ddh-UF / ddh-UR and ddh-DF16 / ddh-DR as primers, PCR amplified P ddh -1, P ddh -10 and P ddh The upstream and downstream homology arms of the -16 promoter mutation; at the same time, the backbone of pK18mobsacB (GenBank: FJ437239.1) was amplified with pK18-1 / 2 primers. After the above two PCR fragments were recovered, they were cloned and ligated by Novizym’s one-step recombination kit to obtain the recombinant vector pK18-P with promoter mutation respectively. ddh -1, pK18-P ddh -10, and pK18-P ddh -16. The sequences of the primers used above are shown in Table 5.
[01...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


