Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Polynucleotides having promoter activity and applications thereof in production of amino acids

A polynucleotide and promoter technology, applied in the fields of molecular biology and bioengineering, can solve problems such as complex transformation process, inability to stably and efficiently produce L-lysine, poor genome stability, etc., and achieve improved promoter activity and stable High-efficiency expression and the effect of improving expression strength

Active Publication Date: 2021-08-03
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0015] In view of the technical problems existing in the prior art, for example: corynebacterium bacteria that increase production by increasing the gene copy number have poor genome stability, and the transformation process of bacterial strains with L-lysine production capacity is complicated, and it is impossible to produce L-lysine stably and efficiently. -Lysine deficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polynucleotides having promoter activity and applications thereof in production of amino acids
  • Polynucleotides having promoter activity and applications thereof in production of amino acids
  • Polynucleotides having promoter activity and applications thereof in production of amino acids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113] Embodiment 1. Construction of Corynebacterium glutamicum ddh gene promoter strength characterization plasmid

[0114] In order to characterize the strength of the ddh gene promoter of Corynebacterium glutamicum, this example first constructs a characterization vector, connects the ddh gene promoter and the ddh gene fragment to the pEC-XK99E plasmid backbone, and uses the ddh gene promoter to express the ddh gene , connecting peptide and red fluorescent protein (rfp) gene. details as follows:

[0115] (1) According to the published genome sequence and ddh gene annotation information of Corynebacterium glutamicum ATCC13032 (Corynebacterium glutamicum ATCC13032, Gene ID: 2830649), primers ddh-F and ddh-R were designed, and ATCC13032 genome was used as a template to amplify by PCR. The ddh gene promoter and the ddh gene fragment are amplified, and the nucleotide sequence of the amplified fragment is shown in SEQ ID NO:34.

[0116] (2) Using the pEC-XK99E-rfp plasmid as a ...

Embodiment 2

[0122] Embodiment 2. Corynebacterium glutamicum ddh gene promoter mutant screening and intensity characterization

[0123] (1) Construction of Corynebacterium glutamicum ddh gene promoter mutant library

[0124] This embodiment is for the core region "TGATGAAAGAGATGTCCCTGAA" of the ddh gene promoter of Corynebacterium glutamicum TC ATCA TCTAAGTATGCATCTCGG TAAGCT CGACCAGG" is mutated, and the underlined parts are the main sequences of the -35 region and -10 region of the promoter respectively. In this embodiment, the mutation "TGATGAAAGAGATGTCCCTGAA is carried out at the corresponding position of the above core region TCATCA TCTAAGTNNNNNNNNGG TAAGCT CGACCAGG", use ddh-M1, ddh-M2 and ddh-M3, ddh-M4 primers to amplify the two fragments of the plasmid respectively, and use Novizym's one-step recombination kit to clone and connect all the obtained clones. Extract plasmid, obtain ddh gene promoter mutant library.In order to compare the disclosed ddh promoter mutant in the p...

Embodiment 3

[0132] Embodiment 3. Corynebacterium glutamicum ddh gene promoter mutant is applied to lysine production

[0133] (1) Recombinant vector construction of Corynebacterium glutamicum ddh gene promoter mutant

[0134] According to the reported genome sequence of Corynebacterium glutamicum ATCC13032, using the ATCC13032 genome as a template, ddh-UF / ddh-UR and ddh-DF1 / ddh-DR, ddh-UF / ddh-UR and ddh-DF10 / ddh -DR, ddh-UF / ddh-UR and ddh-DF16 / ddh-DR as primers, PCR amplified P ddh -1, P ddh -10 and P ddh The upstream and downstream homology arms of the -16 promoter mutation; at the same time, the backbone of pK18mobsacB (GenBank: FJ437239.1) was amplified with pK18-1 / 2 primers. After the above two PCR fragments were recovered, they were cloned and ligated by Novizym’s one-step recombination kit to obtain the recombinant vector pK18-P with promoter mutation respectively. ddh -1, pK18-P ddh -10, and pK18-P ddh -16. The sequences of the primers used above are shown in Table 5.

[01...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present disclosure relates to polynucleotides having promoter activity and applications thereof in the production of amino acids. Specifically, the present disclosure relates to a polynucleotide having promoter activity, a transcription expression cassette containing the polynucleotide, a recombinant expression vector, a recombinant host cell, a method for enhancing expression of a target gene, a method for preparing a protein, and a method for producing an amino acid. The polynucleotide with the promoter activity is a mutant of the polynucleotide with the sequence as shown in SEQ ID NO: 9, compared with the polynucleotide with the sequence as shown in SEQ ID NO: 9, the promoter activity of the mutant is remarkably enhanced, stable and efficient expression of a target gene can be promoted, and then downstream products can be stably and efficiently produced.

Description

technical field [0001] The disclosure belongs to the fields of molecular biology and bioengineering, and specifically relates to a polynucleotide with promoter activity, a transcription expression cassette comprising a polynucleotide with promoter activity, a recombinant expression vector, a recombinant host cell, and an enhanced target gene Methods of expression, methods of making proteins and methods of producing amino acids. Background technique [0002] The chemical name of lysine is 2,6-diaminopimelic acid, which is an essential amino acid for animals and humans. It can promote human development, enhance immunity, and improve the function of central nervous tissue. Lysine has three chemical optical isomers: L-type (left-handed), D-type (dextral) and DL-type (racemic), of which only the L-type can be used by organisms, commonly known as lysine The acid is L-lysine. [0003] L-lysine is one of the 20 common amino acids that make up proteins, and it belongs to basic amin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/77C12N15/53C12N1/21C12P13/08C12R1/15
CPCC12N9/0016C12N15/77C12P13/08C12Y104/01016C12N2800/101
Inventor 郑平刘娇孙际宾周文娟石拓郭轩马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com