Supercharge Your Innovation With Domain-Expert AI Agents!

Primer designed for TCR with epitope being FLYALALL and application of primer

A site, epitope technology, applied in the field of plasmid cloning, can solve the problem of no cloning and so on

Inactive Publication Date: 2021-08-06
GUANGDONG TCRCURE BIOPHARMA TECHNOLOGY CO LTD
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no primers for cloning the gene sequences of these 15 TCRs into plasmid vectors in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer designed for TCR with epitope being FLYALALL and application of primer
  • Primer designed for TCR with epitope being FLYALALL and application of primer
  • Primer designed for TCR with epitope being FLYALALL and application of primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Example of primer pair design: take SEQ ID NO.1 and SEQ ID NO.2 as examples.

[0083] Forward primer (SEQ ID NO.1): GGCCGCGCCACCATGGCCACA;

[0084] Reverse primer (SEQ ID NO. 2): TTACGTAGGTCCTCAGCACGGTCAG.

Embodiment 2

[0085] Embodiment 2 vector construction

[0086] Its method of carrier construction comprises the steps:

[0087] 1. Perform PCR amplification after TCR gene synthesis Use the synthesized TCR gene as a template, and use SEQ ID NO.1 and SEQ ID NO.2 for PCR amplification; the PCR reaction system is as follows: PCR master mix 25 μl, forward primer 5 μl, primer Concentration: 10μm / μl, reverse primer 5μl, primer concentration: 10μm / μl, synthetic TCR gene sequence 1μl, concentration: 10ng / μl, Nuclease-Free Water 14μl, total reaction system 50μl; PCR reaction program: 98℃, 2min; (98°C, 15s; 64°C, 15s; 72°C, 20s) 30 cycles; 72°C, 2min.

[0088] 2. PCR product gel recovery

[0089] Perform agarose gel electrophoresis on the PCR product in step 1, and then recover the gel. For the specific steps, refer to the kit TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 manual, prepare an agarose gel, run electrophoresis on the recovered product fragments, and the result like figure 1 ...

Embodiment 3

[0098] The use of embodiment 3 carrier

[0099] This process includes the preparation of virus fluid and the transfection of cells. The detailed process is as follows:

[0100] 1. Preparation of virus liquid

[0101] 293FT cells were transfected with Lipo3000, and seeded into 6-well culture plates at an appropriate cell density the day before transfection. For detailed steps of Lipo3000 reagent transfection procedure, please refer to Reagent Invitrogen TM Lipofectamine TM 3000Transfection Reagent; 37℃, 5%CO 2 After culturing for 48 hours, aspirate the medium supernatant for transfection;

[0102] 2. Virus transfection into Jurkat cells

[0103] On the second day after transfection of 293T cells, coat the 24-well culture plate with Retronectin, and set aside overnight at 4°C; add the virus liquid to the 24-well culture plate coated with Retronectin, centrifuge at 2000g for 2 hours at 32°C, and discard the supernatant Add an appropriate amount of transfected Jurkat cells t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of plasmid cloning. The invention provides a primer designed for a TCR with an epitope being FLYALALL and application of the primer. The primer pair comprises one or more of primer pairs with the loci of L2-1, L2-2, L2-3, L2-5, L2-6, L2-9, L2-10, L2-11, L2-12, L2-13, L2-16, L2-19, L2-23, L2-24, L2-25 and the like. The primer pair disclosed by the invention is designed aiming at TCR of an EBV virus antigen peptide fragment in a patient of which the typing is HLA A02 and the epitope is FLYALALL, and cloning of a specific plasmid can be realized.

Description

technical field [0001] The invention relates to the technical field of plasmid cloning, in particular to a primer designed for a TCR whose episite is FLYALALLL and an application thereof. Background technique [0002] A vector is a vehicle by which a polynucleotide sequence (eg, a foreign gene) can be introduced into a host cell in order to transform the host and facilitate expression (eg, transcription and translation) of the introduced sequence. Vectors include plasmids, phages, viruses, and the like. The most common type of vector is a plasmid, which refers to a closed circular double-stranded DNA loop into which additional DNA segments containing the gene of interest can be ligated. Another type of vector is a viral vector, in which the nucleic acid construct to be transported is ligated into the viral genome. Viral vectors can replicate autonomously in the host cell into which they are introduced, or can integrate themselves into the genome of the host cell, thereby r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C07K14/725
CPCC12N15/11C07K14/7051
Inventor 张立峰窦浪贾杨彦圣
Owner GUANGDONG TCRCURE BIOPHARMA TECHNOLOGY CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com