Preparation method of antibodies

Abstract

The invention relates to a preparation method of antibodies. Aiming at the conditions that the existing PD-1 antibody or PD-L1 antibody cannot be used for re-detecting PD-1 or PD-L1 recognized cells, the sensitivity is poor, the specificity is general and the like, a PD-1 antibody and a PD-L1 antibody are prepared by constructing specific antigens through genetic engineering and screening by using a hybridoma technology. The detection antibodies prepared by the invention are small in steric hindrance, strong in specificity and high in sensitivity, does not compete for recognition sites with anti-cancer drugs, and also can rapidly detect PD-1 and PD-L1 with relatively low content.

Description

technical field

[0001] The invention relates to the field of biological protein detection, in particular to a method for preparing a specific monoclonal antibody. Background technique

[0002] Programmed cell death protein 1 (PD-1), also known as CD279, is a cell surface receptor that interacts with its ligand PD-L1 to inhibit the activity of T cells. PD-1 exerts its inhibitory effect through a dual mechanism, promoting the apoptosis of antigen-specific T cells in lymph nodes while reducing the apoptosis of regulatory T cells. Through these mechanisms, PD-1 plays a key role in peripheral tolerance and can prevent autoimmune diseases. However, studies have found that PD-L1 is highly expressed in a variety of tumor cells such as lung cancer, ovarian cancer, melanoma and colon cancer. PD-L1 binds to PD-1 on T cells and inhibits the proliferation and activation of T cells. , inducing immune escape of tumor cells.

[0003] Current anti-PD-1 and anti-PD-L1 therapies have achiev...

Examples

Embodiment 1

[0037] 1. Preparation of PD-1 immunogen:

[0038] (1) Cell culture: 293T cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in an incubator at 37°C and 5% CO2.

[0039] (2) Gene PCR amplification: Extraction of total cellular RNA and RT-PCR respectively extract 13 μg RNA from normal PBMC, reverse transcribe to obtain cDNA, and use cDNA as template to amplify to obtain PD-1 gene fragment; Forward primer: TATGGATTCGCCACCATGCAGATCCCACAGGCGC, Reverse primer : TATGTCGACTCAGAGGGGCCAAGAG; PCR reaction conditions: 94°C, 2min, 94°C, 45s, 57°C, 45s, 72°C, 90s, 30 cycles, 72°C, 10min. The kit recovers fragments.

[0040](3) Construction and identification of pCBM-CMV-PD1 eukaryotic vector: the product was recovered after double digestion of pCBM, CMV and plasmid pCDNA3.1-MCS with restriction endonuclease BamhI and salI; the product was digested with TaKaRaDNALigaionKit After fragment ligation, transformed 293T cells, cultured overnight at 37°C, transfected SP2 / 0 ...

Embodiment 2

[0046] 1. Preparation of PD-L1 immunogen:

[0047] (1) Cell culture: 293T cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in an incubator at 37°C and 5% CO2.

[0048] (2) Gene PCR amplification: Extraction of total cellular RNA and RT-PCR respectively extract 13 μg RNA from normal PBMC, reverse transcribe to obtain cDNA, and use cDNA as template to amplify to obtain PD-L1 gene fragment; Forward primer: ATAAGATCTGCCACCATGAGGATATTTGCTGTCTTTAT, Reverse primer : ATAGTCGACTTACGTCTCTCCAAATGTGT; PCR reaction conditions: 94°C, 2min, 94°C, 45s, 57°C, 45s, 72°C, 90s, 30 cycles, 72°C, 10min. The kit recovers fragments.

[0049] (3) Construction and identification of pCBM-CMV-PDL1 eukaryotic vector: Recover the products after double digestion of pCBM, CMV and plasmid pCDNA3.1-MCS with restriction endonucleases bgl2 and salI; digest with TaKaRaDNALigaionKit After fragment ligation, transformed 293T cells, cultured overnight at 37°C, transfected SP2 / 0 and HEK293 ...

Embodiment 3

[0055] Antibody and Dye Conjugation Methods

[0056] (1) Take an appropriate amount of purified antibody of the present invention, dilute the protein concentration of the antibody solution to 20mg / ml with 0.025mol / L pH9.0 carbonate buffer, and place the solution in an ice bath;

[0057] (2) Take a fluorescent dye equivalent to 1 / 100 of the antibody protein and dissolve it in 0.5mol / L pH9.5 carbonate buffer with 1 / 10 of the antibody solution (the solution should be prepared and used immediately);

[0058] (3) Slowly drop the prepared dye solution into the antibody solution under the slow stirring of the electromagnetic stirrer, pay attention to avoid the generation of air bubbles, and add it within about 5-10 minutes;

[0059] (4) After sealing the container with a stopper, place it together with an electromagnetic stirrer at 4°C, and continue stirring slowly to allow the fluorescent dye to bind (couple) to the antibody for 12-18 hours;

[0060] (5) Centrifuge the conjugate (3...

technical field

[0001] The invention relates to the field of biological protein detection, in particular to a method for preparing a specific monoclonal antibody. Background technique

[0002] Programmed cell death protein 1 (PD-1), also known as CD279, is a cell surface receptor that interacts with its ligand PD-L1 to inhibit the activity of T cells. PD-1 exerts its inhibitory effect through a dual mechanism, promoting the apoptosis of antigen-specific T cells in lymph nodes while reducing the apoptosis of regulatory T cells. Through these mechanisms, PD-1 plays a key role in peripheral tolerance and can prevent autoimmune diseases. However, studies have found that PD-L1 is highly expressed in a variety of tumor cells such as lung cancer, ovarian cancer, melanoma and colon cancer. PD-L1 binds to PD-1 on T cells and inhibits the proliferation and activation of T cells. , inducing immune escape of tumor cells.

[0003] Current anti-PD-1 and anti-PD-L1 therapies have achiev...

Examples

Embodiment 1

[0037] 1. Preparation of PD-1 immunogen:

[0038] (1) Cell culture: 293T cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in an incubator at 37°C and 5% CO2.

[0039] (2) Gene PCR amplification: Extraction of total cellular RNA and RT-PCR respectively extract 13 μg RNA from normal PBMC, reverse transcribe to obtain cDNA, and use cDNA as template to amplify to obtain PD-1 gene fragment; Forward primer: TATGGATTCGCCACCATGCAGATCCCACAGGCGC, Reverse primer : TATGTCGACTCAGAGGGGCCAAGAG; PCR reaction conditions: 94°C, 2min, 94°C, 45s, 57°C, 45s, 72°C, 90s, 30 cycles, 72°C, 10min. The kit recovers fragments.

[0040](3) Construction and identification of pCBM-CMV-PD1 eukaryotic vector: the product was recovered after double digestion of pCBM, CMV and plasmid pCDNA3.1-MCS with restriction endonuclease BamhI and salI; the product was digested with TaKaRaDNALigaionKit After fragment ligation, transformed 293T cells, cultured overnight at 37°C, transfected SP2 / 0 ...

Embodiment 2

[0046] 1. Preparation of PD-L1 immunogen:

[0047] (1) Cell culture: 293T cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in an incubator at 37°C and 5% CO2.

[0048] (2) Gene PCR amplification: Extraction of total cellular RNA and RT-PCR respectively extract 13 μg RNA from normal PBMC, reverse transcribe to obtain cDNA, and use cDNA as template to amplify to obtain PD-L1 gene fragment; Forward primer: ATAAGATCTGCCACCATGAGGATATTTGCTGTCTTTAT, Reverse primer : ATAGTCGACTTACGTCTCTCCAAATGTGT; PCR reaction conditions: 94°C, 2min, 94°C, 45s, 57°C, 45s, 72°C, 90s, 30 cycles, 72°C, 10min. The kit recovers fragments.

[0049] (3) Construction and identification of pCBM-CMV-PDL1 eukaryotic vector: Recover the products after double digestion of pCBM, CMV and plasmid pCDNA3.1-MCS with restriction endonucleases bgl2 and salI; digest with TaKaRaDNALigaionKit After fragment ligation, transformed 293T cells, cultured overnight at 37°C, transfected SP2 / 0 and HEK293 ...

Embodiment 3

[0055] Antibody and Dye Conjugation Methods

[0056] (1) Take an appropriate amount of purified antibody of the present invention, dilute the protein concentration of the antibody solution to 20mg / ml with 0.025mol / L pH9.0 carbonate buffer, and place the solution in an ice bath;

[0057] (2) Take a fluorescent dye equivalent to 1 / 100 of the antibody protein and dissolve it in 0.5mol / L pH9.5 carbonate buffer with 1 / 10 of the antibody solution (the solution should be prepared and used immediately);

[0058] (3) Slowly drop the prepared dye solution into the antibody solution under the slow stirring of the electromagnetic stirrer, pay attention to avoid the generation of air bubbles, and add it within about 5-10 minutes;

[0059] (4) After sealing the container with a stopper, place it together with an electromagnetic stirrer at 4°C, and continue stirring slowly to allow the fluorescent dye to bind (couple) to the antibody for 12-18 hours;

[0060] (5) Centrifuge the conjugate (3...

Images