Preparation method of antibodies

A technology of antibody and monoclonal antibody, applied in the field of biological protein detection, can solve the problems of large steric hindrance, unpredictability, unfavorable observation, etc., and achieve good results

Active Publication Date: 2021-08-20
河南凯普瑞生物技术有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in clinical practice, its actual efficacy is still unstable and difficult to predict
After the treatment of the patient, due to the excessive steric hindrance after the combination of the antigen and antibody of the cell itself, the existing PD-1 antibody or PD-L1 antibody cannot re-identify the cells that have been recognized by PD-1 or PD-L1. It is beneficial to the further observation of patients after treatment, and affects the timely diagnosis and treatment of patients in clinical practice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of antibodies
  • Preparation method of antibodies
  • Preparation method of antibodies

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. Preparation of PD-1 immunogen:

[0038] (1) Cell culture: 293T cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in an incubator at 37°C and 5% CO2.

[0039] (2) Gene PCR amplification: Extraction of total cellular RNA and RT-PCR respectively extract 13 μg RNA from normal PBMC, reverse transcribe to obtain cDNA, and use cDNA as template to amplify to obtain PD-1 gene fragment; Forward primer: TATGGATTCGCCACCATGCAGATCCCACAGGCGC, Reverse primer : TATGTCGACTCAGAGGGGCCAAGAG; PCR reaction conditions: 94°C, 2min, 94°C, 45s, 57°C, 45s, 72°C, 90s, 30 cycles, 72°C, 10min. The kit recovers fragments.

[0040](3) Construction and identification of pCBM-CMV-PD1 eukaryotic vector: the product was recovered after double digestion of pCBM, CMV and plasmid pCDNA3.1-MCS with restriction endonuclease BamhI and salI; the product was digested with TaKaRaDNALigaionKit After fragment ligation, transformed 293T cells, cultured overnight at 37°C, transfected SP2 / 0 ...

Embodiment 2

[0046] 1. Preparation of PD-L1 immunogen:

[0047] (1) Cell culture: 293T cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in an incubator at 37°C and 5% CO2.

[0048] (2) Gene PCR amplification: Extraction of total cellular RNA and RT-PCR respectively extract 13 μg RNA from normal PBMC, reverse transcribe to obtain cDNA, and use cDNA as template to amplify to obtain PD-L1 gene fragment; Forward primer: ATAAGATCTGCCACCATGAGGATATTTGCTGTCTTTAT, Reverse primer : ATAGTCGACTTACGTCTCTCCAAATGTGT; PCR reaction conditions: 94°C, 2min, 94°C, 45s, 57°C, 45s, 72°C, 90s, 30 cycles, 72°C, 10min. The kit recovers fragments.

[0049] (3) Construction and identification of pCBM-CMV-PDL1 eukaryotic vector: Recover the products after double digestion of pCBM, CMV and plasmid pCDNA3.1-MCS with restriction endonucleases bgl2 and salI; digest with TaKaRaDNALigaionKit After fragment ligation, transformed 293T cells, cultured overnight at 37°C, transfected SP2 / 0 and HEK293 ...

Embodiment 3

[0055] Antibody and Dye Conjugation Methods

[0056] (1) Take an appropriate amount of purified antibody of the present invention, dilute the protein concentration of the antibody solution to 20mg / ml with 0.025mol / L pH9.0 carbonate buffer, and place the solution in an ice bath;

[0057] (2) Take a fluorescent dye equivalent to 1 / 100 of the antibody protein and dissolve it in 0.5mol / L pH9.5 carbonate buffer with 1 / 10 of the antibody solution (the solution should be prepared and used immediately);

[0058] (3) Slowly drop the prepared dye solution into the antibody solution under the slow stirring of the electromagnetic stirrer, pay attention to avoid the generation of air bubbles, and add it within about 5-10 minutes;

[0059] (4) After sealing the container with a stopper, place it together with an electromagnetic stirrer at 4°C, and continue stirring slowly to allow the fluorescent dye to bind (couple) to the antibody for 12-18 hours;

[0060] (5) Centrifuge the conjugate (3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a preparation method of antibodies. Aiming at the conditions that the existing PD-1 antibody or PD-L1 antibody cannot be used for re-detecting PD-1 or PD-L1 recognized cells, the sensitivity is poor, the specificity is general and the like, a PD-1 antibody and a PD-L1 antibody are prepared by constructing specific antigens through genetic engineering and screening by using a hybridoma technology. The detection antibodies prepared by the invention are small in steric hindrance, strong in specificity and high in sensitivity, does not compete for recognition sites with anti-cancer drugs, and also can rapidly detect PD-1 and PD-L1 with relatively low content.

Description

technical field [0001] The invention relates to the field of biological protein detection, in particular to a method for preparing a specific monoclonal antibody. Background technique [0002] Programmed cell death protein 1 (PD-1), also known as CD279, is a cell surface receptor that interacts with its ligand PD-L1 to inhibit the activity of T cells. PD-1 exerts its inhibitory effect through a dual mechanism, promoting the apoptosis of antigen-specific T cells in lymph nodes while reducing the apoptosis of regulatory T cells. Through these mechanisms, PD-1 plays a key role in peripheral tolerance and can prevent autoimmune diseases. However, studies have found that PD-L1 is highly expressed in a variety of tumor cells such as lung cancer, ovarian cancer, melanoma and colon cancer. PD-L1 binds to PD-1 on T cells and inhibits the proliferation and activation of T cells. , inducing immune escape of tumor cells. [0003] Current anti-PD-1 and anti-PD-L1 therapies have achiev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28
CPCC07K16/2818C07K16/2827Y02A50/30
Inventor 王辉张赟
Owner 河南凯普瑞生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap