Oncolytic virus NDV-NRP1 and construction method and application thereof
A construction method and technology of Newcastle disease virus, applied in the direction of application, virus, virus/phage, etc., can solve problems such as lack
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] 1. Materials
[0034] 1.1 Gene sequence
[0035] In this experiment, cDNA infectious clones NDV-NRP1-scFv, NDV-GT and NDV-NRP1-scFv-GT (NRP1 -The P2A sequence is used as the Linker between the scFv gene and the α1,3GT gene), and the reverse genetic technology is used to rescue the recombinant virus. The plasmids (pcDNA3.1-GT, pcDNA3.1-NRP1-scFv-GT) and primers used in this experiment were synthesized and purified by Shanghai Sangon Bioengineering Co., Ltd. The gene sequence is as follows:
[0036] NRP1-scFv sequence (726bp) SEQ ID NO.1:
[0037]ATGGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGTTATTATATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCGATCTCTCCTGGTAGTAGTAATAAATATTACGCTGATTCTGTAAAAGGTCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAAGGAAGTATATGTTCGACTACTGGGGCCAGGGTACACTGGTCACCGTGAGCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGAATCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


