Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for killing specific tumour cell by recin

A technology of ricin and tumor cells, applied in the field of genetic engineering, can solve the problems of difficult transfection of adenovirus, restriction of gene transfer of adenovirus vector, etc. Effect

Inactive Publication Date: 2005-01-26
FUDAN UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Lack of either of these two target cytokines limits efficient gene delivery by adenoviral vectors
Studies on primary tumors (primary cell lines, primary grafts, intact primary tumor specimens) have shown that many epithelial cell carcinomas lack CARs, making it difficult for adenoviruses to transfect primary tumor cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0043] Example one, the cloning of ricin B chain gene

[0044] The top leaves of castor were picked in autumn, and genomic DNA was extracted with the Huashun Bioengineering Company kit according to its instructions. PCR amplification of ricin B chain, PCR primers:

[0045] P1 5'GTCGACATGGCTGATGTTTGTATGGATCC 3'(Sal I)

[0046] P2 5′CTCGAGTCAAAATAATGGTAACCATATTTGG 3′(Xho I)

[0047] Using the PCR Kit of TaKaRa Biotechnology Company, according to the instructions provided by the kit, the gene of about 800 bp was obtained by agarose electrophoresis. The gene is installed in the T vector, and the base sequence is the same as that of the ricin B chain gene reported in the literature. The results are shown in SEQ ID NO 1.

example 2

[0048] Example two, ricin, ricin A chain protein purification and activity determination

[0049] Castor seeds were obtained from the Institute of Oil Crops, Chinese Academy of Agricultural Sciences. The seeds are manually dehulled for ricin extraction. The extraction method was carried out in accordance with Biochemistry.1973 for the purification and activity determination of ricin A chain protein. Follow the method described in Tan Lisong's article (Tumor (6) 1986: 363).

example 3

[0050] Example three, construction and identification of E1a-containing adenovirus (AD-E1a-CMV-RTB) containing E1a for expressing ricin B chain using CMV promoter

[0051] The reproductive adenoviral plasmid expressing ricin B chain and E1 deletion was constructed by homologous recombination of pADeasy-1 and pShuttle-CMV viral plasmids purchased from stratagene. The pADeasy-1 adenovirus plasmid is a gene deletion in the E1 and E3 regions, and it is a virus gene that can reproduce in 293 cells. The pShuttle-CMV virus plasmid with multiple cloning sites for inserted genes can be homologously recombined with pADeasy-1 in Escherichia coli BJ5183-AD-1, and the pShuttle-CMV gene can be integrated into the virus genome. The operation of constructing AD-E1a-CMV-RTB is as follows:

[0052] 1. Construction of ricin B chain gene with SV40 replication termination sequence

[0053] Using pShuttle-CMV as a template, the SV40 replication termination sequence was amplified by PCR. The PCR ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention concerns gene engineering technology field and provides a system for tumor cell killing by toxins. The invention specifically expresses the recin B chain protein in tumor cell by making use of gene recombination technology, and intravenous injects the recin A chain protein to form an active toxin inside the tumor tissue for exertion of killing tumor cell. The invention conquers the difficulty of toxin disabling to express in the tumor cell and realizes specific and highly effective killing to tumor cells. In addition, it can kill the peripheral tumor tissue of the target cell.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and provides a method for killing specific tumor cells with ricin. Background technique [0002] A hundred years ago, medical scientists had discovered that some tumor patients would experience temporary tumor regression after being infected by viruses, and began to imagine trying various viruses to treat tumors. In the early 1970s, 38 viruses were found to have a therapeutic effect on tumors, and clinical trials began. However, due to factors such as production, purification technology, and virus toxicity at that time, their clinical efficacy was not satisfactory. By the early 1990s, Martuza et al. used genetic engineering methods to modify the virus genome, so that the ability of the virus to infect, replicate, and dissolve cells was effectively enhanced in tumor cells, while this ability weakened or even disappeared in normal cells. The virus can specifically kill tumor cells, but ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P35/00C12N15/861
Inventor 谈立松张培德钟江李逸平张尚权刘岽唐亮
Owner FUDAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More