Method for killing specific tumour cell by recin

A technology of tumor cells and ricin, applied in the field of genetic engineering, can solve the problems of difficult transfection of adenovirus and restriction of gene transfer of adenovirus vectors, and achieve the goal of less toxic and side effects of the body, large room for improvement, and improved expression specificity Effect

Inactive Publication Date: 2009-08-19
FUDAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Lack of either of these two target cytokines limits efficient gene delivery by adenoviral vectors
Studies on primary tumors (primary cell lines, primary grafts, intact primary tumor specimens) have shown that many epithelial cell carcinomas lack CARs, making it difficult for adenoviruses to transfect primary tumor cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for killing specific tumour cell by recin
  • Method for killing specific tumour cell by recin
  • Method for killing specific tumour cell by recin

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0044] Example one, the cloning of ricin B chain gene

[0045] The top leaves of castor were picked in autumn, and genomic DNA was extracted with the Huashun Bioengineering Company kit according to its instructions. PCR amplification of ricin B chain, PCR primers:

[0046] P15'GTCGACATGGCTGATGTTTGTATGGATCC 3'(Sal I)

[0047] P25'CTCGAGTCAAAATAATGGTAACCATATTTGG 3'(Xho I)

[0048] Using the PCR Kit of TaKaRa Biotechnology Company, according to the instructions provided by the kit, the gene of about 800 bp was obtained by agarose electrophoresis. The gene is installed in the T vector, and the base sequence is the same as that of the ricin B chain gene reported in the literature. The results are shown in SEQ ID NO 1.

example 2

[0049] Example two, ricin, ricin A chain protein purification and activity determination

[0050] Castor seeds were obtained from the Institute of Oil Crops, Chinese Academy of Agricultural Sciences. The seeds are manually dehulled for ricin extraction. The extraction method was carried out in accordance with Biochemistry.1973 for the purification and activity determination of ricin A chain protein. Follow the method described in Tan Lisong's article (Tumor (6) 1986: 363).

example 3

[0051] Example three, construction and identification of E1a-containing adenovirus (AD-E1a-CMV-RTB) containing E1a for expressing ricin B chain using CMV promoter

[0052] The reproductive adenoviral plasmid expressing ricin B chain and E1 deletion was constructed by homologous recombination of pADeasy-1 and pShuttle-CMV viral plasmids purchased from stratagene. The pADeasy-1 adenovirus plasmid is a gene deletion in the E1 and E3 regions, and it is a virus gene that can reproduce in 293 cells. The pShuttle-CMV virus plasmid with multiple cloning sites for inserted genes can be homologously recombined with pADeasy-1 in Escherichia coli BJ5183-AD-1, and the pShuttle-CMV gene can be integrated into the virus genome. The operation of constructing AD-E1a-CMV-RTB is as follows:

[0053] 1. Construction of ricin B chain gene with SV40 replication termination sequence

[0054] Using pShuttle-CMV as a template, the SV40 replication termination sequence was amplified by PCR. The PCR ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of genetic engineering and provides a system for killing tumor cells with toxin. The invention uses gene recombination technology to specifically express ricin B chain protein in tumor cells, and at the same time injects ricin A chain protein intravenously, thereby forming active toxin in tumor tissue and killing tumor cells. The invention overcomes the difficulty that the toxin cannot be expressed in tumor cells, and realizes specific and efficient killing of tumor cells. In addition, this system can also kill the tumor tissue around the target cells. When the invention is applied to killing tumor cells, it has the characteristics of high sensitivity, strong specificity, little toxic and side effects to the body, and the like.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and provides a method for killing specific tumor cells with ricin. Background technique [0002] A hundred years ago, medical scientists had discovered that some tumor patients would experience temporary tumor regression after being infected by viruses, and began to imagine trying various viruses to treat tumors. In the early 1970s, 38 viruses were found to have a therapeutic effect on tumors, and clinical trials began. However, due to factors such as production, purification technology, and virus toxicity at that time, their clinical efficacy was not satisfactory. By the early 1990s, Martuza et al. used genetic engineering methods to modify the virus genome, so that the ability of the virus to infect, replicate, and dissolve cells was effectively enhanced in tumor cells, while this ability weakened or even disappeared in normal cells. The virus can specifically kill tumor cells, but ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00A61P35/00C12N15/861
Inventor 谈立松张培德钟江李逸平张尚权刘岽唐亮
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap