Cell model for Alzheimer's disease and construction method of cell model
A technology of cell model and construction method, which is applied in the field of Alzheimer's disease cell model and its construction, can solve the problems of low overexpression, reduction of Aβ drug effect research and mechanism research, and inapplicability, so as to achieve early Aβ The effect of plaque formation
Pending Publication Date: 2021-10-01
INST OF CHINESE MATERIA MEDICA CHINA ACAD OF CHINESE MEDICAL SCI
View PDF4 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Among them, the model of Aβ direct induction of nerve cells simulates the model of Aβ damaged nerve cells, which is suitable for the research of drugs with neuroprotection, but not suitable for the study of drug efficacy and mechanism of reducing Aβ production; while lentivirus induction The single-transgenic model exhibits limited AD symptoms, and the overexpression of Aβ is less than that of double-transgenic cells
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0034] Step 1: PCR amplification of target gene
[0035] According to the gene coding region (CDS) of APP695 and PS1-DE9 provided by NCBI, the synthetic genes APP695 and PS1-DE9 are composed of three parts: A: APP695 fragment, the nucleotide sequence is shown in SEQ ID NO:1, B: ZYY1 fragment, C: The nucleotide sequence of the PS1-DE9 fragment is shown in SEQ ID NO: 2, and three pairs of specific primers were designed to amplify the target fragments A, B, and C respectively by PCR, and part B serves as a bridge to connect A Part and part C are connected to obtain the target gene, and the primer sequence of part B is as follows:
[0036] ZYY1-F1: GGATCCGGCGCAACAAACTTCTC;
[0037] ZYY1-R1: GGTTGTGGCCATATTATCATCGT.
[0038] The PCR reaction system was 50 μl, containing 10 μl of 5×Buffer, 4 μl of 1×dNTP (2.5 mmol / L), 1 μl of forward and reverse primers (10 μmol / L), 0.5 μl of PrimeSTAR, and 50 μl of sterilized water.
[0039] The PCR reaction conditions were as follows: 30 cycles...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention discloses a cell model for the Alzheimer's disease and a construction method thereof, belonging to the technical field of cell models. The cell model is a human astroglioma cell which carries and can express an APP695 gene and a PSI-DE9 gene. The construction method of the cell model comprises the following steps: connecting the APP695 gene and the PSI-DE9 gene with a lentiviral expression vector to construct a recombinant plasmid, introducing the recombinant plasmid through lentivirus, and carrying out screening and culturing to obtain a cell strain which can stably express the APP695 gene and the PSI-DE9 gene. In addition, the cell model also has the characteristics of neuroinflammation, can be used as the Alzheimer's disease cell model for researching the pathogenesis and pathological process of the Alzheimer's disease and screening new drugs for preventing and treating the Alzheimer's disease.
Description
technical field [0001] The invention relates to the technical field of cell models, in particular to an Alzheimer's disease cell model and a construction method thereof. Background technique [0002] Alzheimer's disease (Alzheimer's disease, AD) is a central nervous system lesion characterized by progressive cognitive dysfunction and behavioral damage. Neurofibrillary tangle (NFT) is a characteristic pathological change of AD, and β-amyloid protein (Aβ) is the main component of senile plaques in AD patients, and Aβ is produced by amyloid precursor protein (β-amyloid precursor protein, APP) Produced by β-secretase and γ-secretase hydrolysis. [0003] APP is a single transmembrane protein that exists widely in various tissues in the body, but its expression level is the highest in brain tissue, and the most abundant in the brain is APP695, which is mainly produced by neurons. Overexpression of APP increases the level of Aβ, and also inhibits the transmission of synaptic exci...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More IPC IPC(8): C12N5/10C12N15/867C12N15/12C12Q1/02
CPCC12N5/0693C12N5/0622C12N15/86C07K14/4711G01N33/5058C12N15/10C12N2740/15043C12N2800/107C12N2503/02G01N2500/10
Inventor 赵海誉王琳娜边宝林王宏洁魏晓露司南周严严
Owner INST OF CHINESE MATERIA MEDICA CHINA ACAD OF CHINESE MEDICAL SCI