DNA coding method and biomedical engineering application of same coding method
A deoxyribonucleic acid, password technology, applied in computer-aided medical procedures, medical informatics, bioinformatics, etc., can solve problems such as insufficient PB units
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Code normalization according to the molecular weight of each base
[0041] In order to standardize the sequence of deoxyribonucleic acid by representing each of the four bases that determine the sequence of deoxyribonucleic acid as a binary two-digit number in a computer language, the molecular weight of each base is analyzed and in figure 1 show. The deoxyribonucleotides (deoxyribonucleotides) in which each base G, A, T, and C are linked to one phosphate group are represented as dGMP, dAMP, dTMP, and dCMP, respectively.
[0042] Each base has a large value in the order of G, A, T, and C, and the molecular weights of C paired with G through a hydrogen bond and T complementary with A are added and compared, and the result is 654.4 (=347.2+307.2 ) and 653.4 (=331.2+322.2), and it was confirmed that they were paired in a state of approximately 1:1 equivalent molecular mass. The reason why the sum of the molecular weights of A and T is 1 smaller than the sum ...
Embodiment 2
[0046] Embodiment 2: The molecular weight ratio reflection optimization of deoxyribonucleic acid fragment and aptamer (Aptamer)
[0047] According to the molecular weight of each base of deoxyribonucleic acid, the codon is assigned in the order of low quality to high quality, therefore, the total codon sum of deoxyribonucleic acid fragments is calculated by reflecting the molecular weight ratio of each sequence ( image 3 ). The six exemplified sequences were used to compare codon sums to molecular weights by confirming the codon's molecular weight reflection ratio.
[0048] The above exemplified sequences are exemplified for the purpose of confirming the molecular weight reflection ratio of the code, and should not be construed as being limited to the sequences of SEQ ID NO: 1 to SEQ ID NO: 6.
[0049] The sequences of the above-mentioned SEQ ID NO: 1 to SEQ ID NO: 6 are as follows.
[0050] 5' AGAGCTCGCGCCGGAGTTTCTCAATGCAAGAGC 3' (SEQ ID NO: 1)
[0051] 5'GCGGCGGTGGCCTG...
Embodiment 3
[0059] Example 3: Optimization of pattern confirmation of deoxyribonucleic acid fragments and aptamers
[0060] The optimization is carried out in the following way: convert the sequences of DNA fragments and aptamers into binary base codes, and compare the sequences to grasp the specific patterns and secondary structures contained in the sequences. In order to grasp it, a deoxyribonucleic acid sequence consisting of 9 base sequences is used as an exemplary sequence ( Figure 4 ).
[0061] The above exemplified sequence is described for the purpose of exemplifying the code mode, and should not be construed as limiting its scope to the exemplified sequence of SEQ ID NO:7.
[0062] An exemplary sequence of the aforementioned SEQ ID NO: 7 is as follows.
[0063] 5'GCGGTGGCG 3' (SEQ ID NO: 7)
[0064] The numbers listed by converting the above exemplary sequences into base codes are as follows.
[0065] 11 00 11 11 01 11 11 00 11 (example sequence password 1)
[0066] Each ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


