Unlock instant, AI-driven research and patent intelligence for your innovation.

DNA coding method and biomedical engineering application of same coding method

A deoxyribonucleic acid, password technology, applied in computer-aided medical procedures, medical informatics, bioinformatics, etc., can solve problems such as insufficient PB units

Pending Publication Date: 2021-11-05
HESSEGG INC
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the capacity is converted into the population, the PB unit is not enough

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA coding method and biomedical engineering application of same coding method
  • DNA coding method and biomedical engineering application of same coding method
  • DNA coding method and biomedical engineering application of same coding method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Code normalization according to the molecular weight of each base

[0041] In order to standardize the sequence of deoxyribonucleic acid by representing each of the four bases that determine the sequence of deoxyribonucleic acid as a binary two-digit number in a computer language, the molecular weight of each base is analyzed and in figure 1 show. The deoxyribonucleotides (deoxyribonucleotides) in which each base G, A, T, and C are linked to one phosphate group are represented as dGMP, dAMP, dTMP, and dCMP, respectively.

[0042] Each base has a large value in the order of G, A, T, and C, and the molecular weights of C paired with G through a hydrogen bond and T complementary with A are added and compared, and the result is 654.4 (=347.2+307.2 ) and 653.4 (=331.2+322.2), and it was confirmed that they were paired in a state of approximately 1:1 equivalent molecular mass. The reason why the sum of the molecular weights of A and T is 1 smaller than the sum ...

Embodiment 2

[0046] Embodiment 2: The molecular weight ratio reflection optimization of deoxyribonucleic acid fragment and aptamer (Aptamer)

[0047] According to the molecular weight of each base of deoxyribonucleic acid, the codon is assigned in the order of low quality to high quality, therefore, the total codon sum of deoxyribonucleic acid fragments is calculated by reflecting the molecular weight ratio of each sequence ( image 3 ). The six exemplified sequences were used to compare codon sums to molecular weights by confirming the codon's molecular weight reflection ratio.

[0048] The above exemplified sequences are exemplified for the purpose of confirming the molecular weight reflection ratio of the code, and should not be construed as being limited to the sequences of SEQ ID NO: 1 to SEQ ID NO: 6.

[0049] The sequences of the above-mentioned SEQ ID NO: 1 to SEQ ID NO: 6 are as follows.

[0050] 5' AGAGCTCGCGCCGGAGTTTCTCAATGCAAGAGC 3' (SEQ ID NO: 1)

[0051] 5'GCGGCGGTGGCCTG...

Embodiment 3

[0059] Example 3: Optimization of pattern confirmation of deoxyribonucleic acid fragments and aptamers

[0060] The optimization is carried out in the following way: convert the sequences of DNA fragments and aptamers into binary base codes, and compare the sequences to grasp the specific patterns and secondary structures contained in the sequences. In order to grasp it, a deoxyribonucleic acid sequence consisting of 9 base sequences is used as an exemplary sequence ( Figure 4 ).

[0061] The above exemplified sequence is described for the purpose of exemplifying the code mode, and should not be construed as limiting its scope to the exemplified sequence of SEQ ID NO:7.

[0062] An exemplary sequence of the aforementioned SEQ ID NO: 7 is as follows.

[0063] 5'GCGGTGGCG 3' (SEQ ID NO: 7)

[0064] The numbers listed by converting the above exemplary sequences into base codes are as follows.

[0065] 11 00 11 11 01 11 11 00 11 (example sequence password 1)

[0066] Each ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a method for code standardization of DNA, the method comprising: (a) assigning codes 00, 01, 10, and 11 to the four bases C, T, A, and G, respectively; and (b) coding base pairs between G and C and between A and T by providing 1100 for G and C, 0011 for C and G, 1001 for A and T, and 0110 for T and A in the 5' to 3' direction. The method for code standardization of DNA according to the present invention provides a method that makes it easy to detect specific patterns present in base sequences such as DNA fragments or aptamers, for example, a method that makes it easy to detect specific patterns and secondary structures in base sequences, mutations of base sequences, etc., and to predict a disease by using disease-specific sequence variations such as SNP, etc.

Description

technical field [0001] The invention relates to a deoxyribonucleic acid (DNA) code standardization method and its optimized application in medical life engineering. Background technique [0002] Deoxyribonucleic acid (DNA, DeoxyriboNucleic Acid), which exists as genetic material in living organisms, consists of gene parts and non-gene parts expressed by proteins. In the chemical structure of deoxyribonucleic acid, a phosphate group is attached to the 5' carbon of the pentose sugar (Deoxyribose) and a base (base) is attached to the 1' carbon to form a monomer called nucleotide (Nucloeotide), In this case, the sequence of the deoxyribonucleic acid is determined based on the type of bases linked to the nucleotides. [0003] There are two types of bases, purine bases having two ring structures and pyrimidine bases having one ring structure. Purines have guanine (G) and adenine (A), pyrimidines have cytosine (C) and thymine (T), etc. In the case of ribonucleic acid (RNA), there...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G16B30/10G16B30/20G16B15/00
CPCG16B20/00G16B50/50G16B30/10G16B30/20G16B15/00G16H50/20G16B20/20G16B15/10G16B50/00
Inventor 孙寅植金显珠
Owner HESSEGG INC