Mutant family heritable pulmonary arterial hypertension virulence gene BMPR2 and application thereof
A technology of pulmonary hypertension and disease-causing genes, applied in the field of human genetics and internal medicine and cardiovascular, to achieve the effect of reducing the birth of children
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Example 1 - Mutated Familial Inherited Pulmonary Hypertension Gene BMPR2
[0019] Mutated familial hereditary pulmonary hypertension pathogenic gene BMPR2, specific mutations are shown in Table 1 below:
[0020] Table 1 Mutations in familial hereditary pulmonary hypertension pathogenic gene BMPR2
[0021] Gene genomic location transcript number base change amino acid changes Reference Genome Version exon number BMPR2 chr2:203242231 NM_001204 c.36delC p.Trp13GlyfsTer34 GRCh37 / hg19 Exon1
[0022] (1) Specifically, at the genomic position chr2:203242198-chr2:203242247, the sequence of the wild-type BMPR2 gene is SEQ ID NO: 1: It is the pre-mutation base at genomic position chr2:203242231;
[0023] At genomic position chr2:203242198-chr2:203242246, the sequence of the mutated BMPR2 gene is SEQ ID NO: 2: ATGACTTCCTCGCTGCAGCGGCCCTGGCGGGTGCCTGGCTACCATGGAC;
[0024] That is, compared with the reference sequence of the wild-type BMP...
Embodiment 2
[0033] Example 2 - in vitro detection kit for the mutation of the family hereditary pulmonary hypertension pathogenic gene BMPR2
[0034] The mutated familial hereditary pulmonary hypertension pathogenic gene BMPR2 in vitro detection kit provided in this embodiment includes specific amplification primers for the target fragment, DNA polymerase and PCR buffer;
[0035] The specific primer information is as follows:
[0036] Upstream primer (BMPR2-E1F, SEQ ID NO:5): 5'CCTCTCATCAGCCATTTGTCC 3'; Downstream primer (BMPR2-E1R, SEQ ID NO:6): 5'AGTGGGGATAGGAAAATACACAA 3'; Length: 433bp.
[0037]This kit specifically uses the Sanger sequencing method, and the specific detection steps are: extract the DNA of the test subject according to the steps in Example 1, and then use the designed primer combination (SEQ ID NO: 5 and SEQ ID NO: 6) to carry out the BMPR2 gene Amplify to obtain the PCR product, use 1.5% agarose gel electrophoresis to detect the PCR product, select 1000bp Marker as ...
Embodiment 3-
[0039] Example 3 - Family Verification
[0040] Since HPAH is monogenic autosomal dominant inheritance, this example adopts the family linkage analysis method to verify the pathogenicity of the mutated familial hereditary pulmonary hypertension pathogenic gene BMPR2.
[0041] Specifically, three-generation members of a family with hereditary pulmonary hypertension were selected. The proband in this family was treated at Fuwai Hospital of the Chinese Academy of Medical Sciences and was clinically diagnosed with hereditary pulmonary hypertension.
[0042] On the premise that the proband (male, 9 years old) and his family voluntarily signed the informed consent, 5-10mL whole blood samples were sent, and a medical record database was established to record the proband's condition, family status and other information in detail. This verification has been approved by the institutional ethics committee.
[0043] Medical history of the proband:
[0044] Table 2 Medical history of the...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com