Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Molecular marker detection kit for primary liver cancer, nucleic acid composition and application

A technology of primary liver cancer and molecular markers, applied in the direction of microbial determination/testing, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of low sensitivity and accuracy, and few blood markers of hepatocellular carcinoma To achieve the effect of reducing morbidity and mortality, increasing the proportion of early diagnosis, and high accuracy of early screening

Active Publication Date: 2021-12-28
苏州艾米森生物科技有限公司
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are few blood markers for hepatocellular carcinoma reported so far, and the sensitivity and accuracy are not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker detection kit for primary liver cancer, nucleic acid composition and application
  • Molecular marker detection kit for primary liver cancer, nucleic acid composition and application
  • Molecular marker detection kit for primary liver cancer, nucleic acid composition and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] This embodiment provides a primary liver cancer diagnostic reagent. It includes a combination of nucleic acids 1.

[0052] The nucleic acid combination 1 includes primer combinations 1 and probe 1, primer combination 1 comprising SEQ ID No. 7-8 nucleotides, and the base sequence of probe 1 refers to SEQ ID NO.9. This nucleic acid combination 1 can detect the methylation level of the CHR2: 25216048-25216151 regional positive chain (destination area 1).

[0053] Regional 1 methylated specific PCR upstream primer sequence is (5'-3 '):

[0054] Gttattcgggcgagtagagtcg (SEQ ID NO.7);

[0055] Downstream primer sequence of region 1 methylated specific PCR (5'-3 '):

[0056] AactacccgcgaaAACTTCCG (SEQ ID No.8);

[0057] Regional 1 methylated specific PCR probes 1 sequence (5'-3 '):

[0058] TcgggTGCGTGGTTTTCGTTCG (SEQ ID NO. 9).

Embodiment 2

[0060] This embodiment provides a primary liver cancer diagnostic reagent. It includes nucleic acid combination 2.

[0061] The nucleic acid combination 2 includes primer combination 2 and probe 2, primer combination 2 including nucleotides represented by SEQ ID NO. 10-11, and the base sequence of probe 2 refers to SEQ ID NO.12. The nucleic acid combination 2 can be detected by the methylation level of the CHR2: 25216146-25216277 regional positive chain (destination area 2).

[0062] Upstream primer sequence of region 2 methylated specific PCR (5'-3 '): gtagttgggaggaaatcgc (seqid no.10);

[0063] Undercapacity sequence of region 2 methylated specific PCR is (5'-3 '):

[0064] AACACTCCGACTAACGCGC (SEQ ID NO.11);

[0065] Regional 2 methylated specific PCR probe 2 sequence is (5'-3 '):

[0066] TTCGTTCGGGAAGGGTAGTGC (SEQ ID NO.12).

Embodiment 3

[0068] This embodiment provides a primary liver cancer diagnostic reagent. It includes a combination of nucleic acids 3.

[0069] The nucleic acid combination 3 includes primer combinations 3 and probe 3, primer combinations 3 including nucleotides represented by SEQ ID NO. 13-14, and the base sequence of probe 3 refers to SEQ ID NO.15. The nucleic acid combination 3 can detect the methylation level of the CHR2: 25216265-25216351 regional positive chain (destination area 3).

[0070] Upstream primer sequence of region 3 methylated specific PCR (5'-3 '): tagtcggggTGTTCGCGTTC (SEQ ID NO.13);

[0071] Undercam primer sequence of region 3 methylated specific PCR (5'-3 '):

[0072] ActacgaActaaACTCCGCAACGT (SEQ ID NO.14);

[0073] Regional 3 methylated specific PCR probe 3 sequence is (5'-3 '):

[0074] TTTTGCGTCGTTTTAGGATTCGTA (SEQ ID NO.15).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker detection kit for primary liver cancer, a nucleic acid composition and application, and relates to the technical field of liver cancer diagnosis. By detecting the methylation level of the CpG site in a Chr2: 25216044-25216394 region and the reverse complementary sequence of the Chr2: 25216044-25216394 region, whether a target sample is the primary liver cancer or not can be identified. The methylation of the CpG site in the region has better sensitivity and specificity on the detection or diagnosis of the primary liver cancer, and can be used for distinguishing a liver cancer sample from a healthy sample as well as a liver cancer sample from a liver cirrhosis sample. The good molecular marker is provided for early screening of liver cancer, and has the advantages of high early screening accuracy, noninvasive property, convenience, safety, rapidness and high throughput. The molecular marker is expected to improve the early diagnosis proportion of people with high risk of hepatocellular carcinoma in China, realizes early discovery and early treatment, and reduces the morbidity and mortality of hepatocellular carcinoma.

Description

Technical field [0001] The present invention relates to the field of diagnosis of liver cancer, and in particular, a molecular marker detection kit, nucleic acid combination and application of primary liver cancer. Background technique [0002] Primary liver cancer is the 4th common malignant tumors in my country and the second tumor death. Primary liver cancer mainly includes hepatocellular carcinoma, hepatic cholangiocarcinoma and hepatocyte carcinoma-hepatic cholangiocarcinoma hybrid type three different pathological types, including 85% to 90% of hepatocyte carcinoma, and its risk factors include a type B / Hepatitis C virus (HBV / HCV) infection, non-alcoholic fatty liver disease, chronic alcohol abuse, etc., these factors may directly lead to the development of cirrhosis, and patients with cirrhosis have 2% -4%. . [0003] At present, the recommended programs recommended by the hepatocyte cancer diagnosis and treatment of my country are high-risk groups, 1 liver ultrasound ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/154C12Q2600/166
Inventor 张玮李国强
Owner 苏州艾米森生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com