Application of hsa_circ_0006470 as target in preparation of miR-27b-3p regulator
A technology of mir-27b-3p and modulators, applied in biochemical equipment and methods, microbe determination/testing, DNA/RNA fragments, etc., can solve problems such as the pathogenic mechanism of gastric cancer that has not been fully elucidated
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1 The interaction of HSA_CIRC_0006470 and MIR-27B-3P is demonstrated by a lucifener report.
[0050] First of all, the wild-type sequence of the synthetic gene of hsa_circ_0006470 (the WT, synthetic primers hsa_circ_0006470.F: ACTCATCATGGACTCCCTGC, hsa_circ_0006470.R: TGAGCACCTCCTTAGCAGACA) and mutant gene sequence (the MUT, synthetic primers hsa_circ_006470X.F: GGGACCGCATCTTCTTTGT, hsa_circ_006470X.R: GTGCTGCTCAAACTTGGTCTT), the Its 3`UTR ends are connected to the report of the Pmilglo vector, respectively, and construct fluorescene enzyme particles (Pmirglo-Circ_006470 WT Vectors or Pmirglo-Circ_006470 MUT VECTORS). The RNA sequence of MIR-27B-3PMIMICS (5'-UuCacaguaAguucugc-3 ') and control group (NC: 5'-uuuguacuacaaaaaguacug-3') was then synthesized by Genepharma Company. Double luciferase reporting experiments were performed using gastric cancer cells (AGS), divided into four groups in Table 2, and experimental data see figure 1 .
[0051] according to figure 1 ...
Embodiment 2
[0054] Example 2HSA_CIRC_0006470 RNAi Experiment
[0055] SiRNAs of HSA_CIRC_0006470, divided into two groups in two groups, one of the groups of SiRNAs transfected into HSA_CIRC_0006470 as a silent group (Si-SIRC-RNA), and another group was transfected using the same transfection. However, SiRNAs did not be added as a control group (Control).
[0056] The expression quantity of HSA_CIRC_0006470 and MIR-27B-3P in the two groups was detected by RT-PCR experiments. figure 2 .
[0057] The expression quantity of the target gene ROR1 in the two groups was detected by RT-PCR experiment, and the experimental data was found. image 3 .
[0058] according to Figure 2-3 The data can be seen that the expression of HSA_CIRC_0006470 in the silence group of the siRNAs transfected with HSA_CIRC_0006470 is significantly reduced relative to the control group, indicating that the silent group succeeds in the HSA_CIRC_0006470. The expression of MiR-27B-3P in the silence group of SiRNAs of HSA_CIRC_0...
Embodiment 3
[0069] Example 3 Effect of Over Expression PIK3CA on the AGS cells of HSA_CIRC_0006470 silencers
[0070] Over-expression plasmids of PIK3ca were synthesized, and the sik3ca and HSA_CIRC_0006470 were transfected into AGS cells in accordance with the same host and transfection conditions in the silencing group and the control group, and the PIK3CA overexpression group (Si-CircRNA + PIK3CA) was obtained.
[0071] The expression level of HSA_CIRC_0006470, PIK3CA and MIR-27B-3P, PIK3CA, and MIR-27B-3P after transfection was detected by RT-PCR experiment, and the experimental data see Figure 10 .
[0072] The expression level of PIK3CA, the PIK3CA, the Pik3ca of the Silent Group, the PIK3CA overdrawn group and the control group was detected by immunofluorescence experiment, and the experimental data see Figure 11 .
[0073] according to Figure 10 and Figure 11 The results were found that the expression of PIK3CA of the PIK3CA over-expression group was significantly up-regulated after t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



