Method for creating corn dwarfing materials based on Zmhb38 gene
A corn, dwarfing technology, applied in the field of genetic engineering, can solve the problems of reducing yield, time-consuming, lodging, etc., and achieve the effect of reducing plant height
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The construction of embodiment 1 gene editing vector
[0035] (1) The gene controlling the plant height of maize is the Zmhb38 gene, and its nucleotide sequence is as follows:
[0036]ATGGCCATCCACCACCCGCACCTCCTCGACTTCTCGCCGCCTCCGAACACGGTGGCCATGGAGGAGGCGCCGCCCCCACCCCACTTCGACCACGGCCTCCTCGGGCTCCATGTCGATGGCATGCCTCATCGCGTCCTCGCCGACGACGCGCCGGTGGCGGCATGGGCGCCGCAGGCCGTGGTCTCCCACTCCCTGTACGGATACGATAACACAGCAGCGGGGGCGTCGTCGCTGTTTGGCCACCATGAGGCATCAGAGGCCCAGTTCTCCGTGCTTCCGCCGGCAGCGTCGTCGTTTGCACTACTACCTAACCACCACCACCAGCAGCAGCTGCCGACGACGACGGCGGCGTCGAGCATGCAGCAGCCGTTCCAGCTGAGGAGCTCCAAGTACCTGGGTCCTGCGCAGGAGCTGCTCGCCGAGTTCTGCAGCCTGGAAGGGGACCTGCTGCACGCCACGAACAAGCAGGGAGCTTCCGGAGCAGCAGCAGGTAACAGCAGGTGGGACGACGTGGAGACGTCGTCGTCTTCTTCTGCTGGCCTCTGGGGGCACCTGTCCCTGAGCTCCATGGATCTCCTGGAGCTCGAGAGGAGGAAGGCCAGGCTCTTGTCCATGGTTGAAGAGGTGGACCGGCGGTACCGGCGATACCGCGAGCAGATGAGGTCAGTGGAGGTGTCGTTCGAGGCGGTGGCCGGAGCCGGCGCGTCGCAGGTGTACACGCGGCTGGCGCTGCGGGCCATGTCGCGGCACTTCCGGTGCCTGCGGGATGCGCTGGTGGCGCAGGTGCGCGCTCTGCGGAAGG...
Embodiment 2
[0054] Example 2 Gene Editing Vector Transformed into Agrobacterium LBA4404
[0055] 1) CaCl 2 Agrobacterium tumefaciens Competent Cells
[0056] (1) From the YEP tablet (Rif R ,Str R ) to inoculate a fresh single colony of LBA4404 in YEP liquid medium containing 50mg / L Str and 25mg / L Rif, culture at 28°C and shake at 220rpm overnight for 24-36h;
[0057] (2) Take 2ml of overnight activated bacterial solution in the logarithmic growth phase, inoculate it in 50mL YEP liquid medium, and culture the bacterial solution OD at 20°C 600 to about 0.4~0.6;
[0058] (3) Transfer the bacterial solution to a 50 mL sterile centrifuge tube pre-cooled with ice, bathe in ice for 30 min, centrifuge at 4,000×g for 10 min at 4°C to enrich the bacterial cells;
[0059] (4) Pre-cool 0.05M CaCl with 10mL ice 2 Suspended cells, ice-bathed for 30 minutes, centrifuged at 4,000×g for 10 minutes at 4°C to enrich the cells;
[0060] (5) Pre-cool 0.05M CaCl with 1mL ice 2 Resuspend the bacteria, s...
Embodiment 3
[0073] Embodiment 3 Maize genetic transformation
[0074] (1) The material for embryo extraction was maize inbred line C01. The immature corn embryos were observed on the ninth day after pollination. When they grew to about 1.5 mm, the ears were taken back to the laboratory for embryo extraction.
[0075] (2) Prepare the Agrobacterium infection solution, and when the activated Agrobacterium is shaken in YEB liquid medium to a specific concentration (OD 550 =0.5), low-speed centrifugation collects the thalline precipitation, then with inf (per liter composition: N6 salt and vitamin (sigma) 2 grams, sucrose 68.5 grams, glucose 36 grams, L-proline 0.7 grams, MES 0.5g, 1mg / ml 2,4-D 1.5ml)+AS (Acetosyringone, (100mM), 1ml)) liquid medium resuspended, shake the bacteria at 75r / min at 25°C for 24h, until the concentration is OD 550 =0.3-0.4 is enough.
[0076] (3) Wash the immature embryos taken out in (1) twice with inf+AS (same as above) liquid medium, then add Agrobacterium infe...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com