Supercharge Your Innovation With Domain-Expert AI Agents!

Method for creating corn dwarfing materials based on Zmhb38 gene

A corn, dwarfing technology, applied in the field of genetic engineering, can solve the problems of reducing yield, time-consuming, lodging, etc., and achieve the effect of reducing plant height

Pending Publication Date: 2022-02-18
JILIN ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] The improvement of corn production in the 20th century mainly relied on increasing the planting density of corn per unit area. However, if the density is too high, there will be the risk of lodging, which may reduce the yield. Therefore, reducing the plant height of corn to a certain extent will help improve corn yield
[0003] The creation of traditional dwarf maize is mainly through the method of backcrossing, which often requires 6 backcrossing generations, which is not only time-consuming, but also often accompanied by gene redundancy, which leads to the introduction of some non-target traits and limits the application of improved materials Effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for creating corn dwarfing materials based on Zmhb38 gene
  • Method for creating corn dwarfing materials based on Zmhb38 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The construction of embodiment 1 gene editing vector

[0035] (1) The gene controlling the plant height of maize is the Zmhb38 gene, and its nucleotide sequence is as follows:

[0036]ATGGCCATCCACCACCCGCACCTCCTCGACTTCTCGCCGCCTCCGAACACGGTGGCCATGGAGGAGGCGCCGCCCCCACCCCACTTCGACCACGGCCTCCTCGGGCTCCATGTCGATGGCATGCCTCATCGCGTCCTCGCCGACGACGCGCCGGTGGCGGCATGGGCGCCGCAGGCCGTGGTCTCCCACTCCCTGTACGGATACGATAACACAGCAGCGGGGGCGTCGTCGCTGTTTGGCCACCATGAGGCATCAGAGGCCCAGTTCTCCGTGCTTCCGCCGGCAGCGTCGTCGTTTGCACTACTACCTAACCACCACCACCAGCAGCAGCTGCCGACGACGACGGCGGCGTCGAGCATGCAGCAGCCGTTCCAGCTGAGGAGCTCCAAGTACCTGGGTCCTGCGCAGGAGCTGCTCGCCGAGTTCTGCAGCCTGGAAGGGGACCTGCTGCACGCCACGAACAAGCAGGGAGCTTCCGGAGCAGCAGCAGGTAACAGCAGGTGGGACGACGTGGAGACGTCGTCGTCTTCTTCTGCTGGCCTCTGGGGGCACCTGTCCCTGAGCTCCATGGATCTCCTGGAGCTCGAGAGGAGGAAGGCCAGGCTCTTGTCCATGGTTGAAGAGGTGGACCGGCGGTACCGGCGATACCGCGAGCAGATGAGGTCAGTGGAGGTGTCGTTCGAGGCGGTGGCCGGAGCCGGCGCGTCGCAGGTGTACACGCGGCTGGCGCTGCGGGCCATGTCGCGGCACTTCCGGTGCCTGCGGGATGCGCTGGTGGCGCAGGTGCGCGCTCTGCGGAAGG...

Embodiment 2

[0054] Example 2 Gene Editing Vector Transformed into Agrobacterium LBA4404

[0055] 1) CaCl 2 Agrobacterium tumefaciens Competent Cells

[0056] (1) From the YEP tablet (Rif R ,Str R ) to inoculate a fresh single colony of LBA4404 in YEP liquid medium containing 50mg / L Str and 25mg / L Rif, culture at 28°C and shake at 220rpm overnight for 24-36h;

[0057] (2) Take 2ml of overnight activated bacterial solution in the logarithmic growth phase, inoculate it in 50mL YEP liquid medium, and culture the bacterial solution OD at 20°C 600 to about 0.4~0.6;

[0058] (3) Transfer the bacterial solution to a 50 mL sterile centrifuge tube pre-cooled with ice, bathe in ice for 30 min, centrifuge at 4,000×g for 10 min at 4°C to enrich the bacterial cells;

[0059] (4) Pre-cool 0.05M CaCl with 10mL ice 2 Suspended cells, ice-bathed for 30 minutes, centrifuged at 4,000×g for 10 minutes at 4°C to enrich the cells;

[0060] (5) Pre-cool 0.05M CaCl with 1mL ice 2 Resuspend the bacteria, s...

Embodiment 3

[0073] Embodiment 3 Maize genetic transformation

[0074] (1) The material for embryo extraction was maize inbred line C01. The immature corn embryos were observed on the ninth day after pollination. When they grew to about 1.5 mm, the ears were taken back to the laboratory for embryo extraction.

[0075] (2) Prepare the Agrobacterium infection solution, and when the activated Agrobacterium is shaken in YEB liquid medium to a specific concentration (OD 550 =0.5), low-speed centrifugation collects the thalline precipitation, then with inf (per liter composition: N6 salt and vitamin (sigma) 2 grams, sucrose 68.5 grams, glucose 36 grams, L-proline 0.7 grams, MES 0.5g, 1mg / ml 2,4-D 1.5ml)+AS (Acetosyringone, (100mM), 1ml)) liquid medium resuspended, shake the bacteria at 75r / min at 25°C for 24h, until the concentration is OD 550 =0.3-0.4 is enough.

[0076] (3) Wash the immature embryos taken out in (1) twice with inf+AS (same as above) liquid medium, then add Agrobacterium infe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for creating corn dwarfing materials based on a Zmhb38 gene, and belongs to the technical field of genetic engineering. According to the method for creating corn dwarfing materials based on a Zmhb38 gene, the corn Zmhb38 gene is subjected to gene editing through a CRISPR / Cas9 technology, mutant materials containing target gene deletion fragments are obtained through further screening, and the corn dwarfing materials have important breeding value.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and more specifically relates to a method for creating dwarf maize materials based on the Zmhb38 gene by using gene editing technology. Background technique [0002] The improvement of corn production in the 20th century mainly relied on increasing the planting density of corn per unit area. However, if the density is too high, there will be the risk of lodging, which may reduce the yield. Therefore, reducing the plant height of corn to a certain extent will help improve corn yield. At the end of the 1960s, the world-famous "Green Revolution" set off a frenzy that semi-dwarf plants could increase yields. High-yield varieties of semi-dwarf rice and wheat were successfully created during the "Green Revolution". Many maize dwarf mutants have been identified over the past few decades but have not been fully utilized in maize breeding. [0003] The creation of traditional dwarf corn is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/84A01H5/00A01H6/46
CPCC12N15/113C12N15/8218C12N15/8205C12N15/8261C12N2310/20
Inventor 宋广树吕庆雪普莉周德龙高嵩
Owner JILIN ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More