Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Compositions and methods for treating alpha-1 antitrypsin deficiency

A technology for antitrypsin and deficiency, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, gene therapy, etc., can solve gene therapy that increases liver A1AT, cannot fully solve A1AT gene defects, cannot solve problems such as liver toxicity

Pending Publication Date: 2022-02-18
BEAM THERAPEUTICS INC
View PDF34 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although lung pathology can be resolved with protein replacement therapy, this therapy also does not resolve liver toxicity
Gene therapy also fails to adequately address A1AT gene defect
Since the livers of A1AD patients already have a severe disease burden from endogenous A1AT, gene therapy to increase hepatic A1AT has the potential to be counterproductive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods for treating alpha-1 antitrypsin deficiency
  • Compositions and methods for treating alpha-1 antitrypsin deficiency
  • Compositions and methods for treating alpha-1 antitrypsin deficiency

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[1203] Example 1: Evolved adenosine base editors with increased editing efficiency

[1204] Base editing systems comprising Tad7.10-dCas9 fusion proteins are capable of editing target polynucleotides with approximately 10-20% efficiency, but their use may be limited for applications requiring higher efficiencies. To identify adenine base editors with improved efficiency and specificity, a construct containing the adenosine deaminase TadA 7.10 was mutagenized by error-prone PCR and subsequently cloned into a DNA-binding protein encoding dCas9 (nucleic acid-programmable DNA-binding protein). In the expression vector adjacent to the nucleic acid sequence ( Figure 1A ). The mutagenized TadA-dCas9 base editor is referred to in these Examples as ABE8 (adenosine deaminase variant). Expression vectors containing adenosine deaminase variants were co-transformed into competent bacterial cells with selection plasmids encoding chloramphenicol resistance (CamR) and spectinomycin resista...

Embodiment 2

[1213] Example 2: Correction of the alpha-1 antitrypsin mutation using ABE8

[1214] Base editing activity of selected ABE8 constructs was tested in HEK293 cells expressing A1AT containing the E342K mutation (HEK293T-E342K). In one scheme, 250ng gRNA plasmid and 750ng ABE8 plasmid [0407] were used to transiently transfect HEK293T-E342K cells with Mirus TransIT293, a highly efficient and low-toxic DNA transfection reagent optimized for HEK293 cells, at a ratio of 3 μl:1 μg. HEK293T-E342K was transfected by Neon electroporation using 2.5ug Var-3 ABE mRNA and 1000ng of 20nt gRNA 191. The gRNA backbone of the sgRNA provided as spCas9 base editor is as follows:

[1215] 5'-GUUUUAGAGC UAGAAAUAGC AAGUUAAAAU AAGGCUAGUC CGUUAUCAAC UUGAAAAAGUGGCACCGAGU CGGUGCUUUU-3'

[1216] Useful gRNAs for the method include the following

[1217] 5’-ACCAUCGACAAGAAAGGGACUGA GUUUUAGAGC UAGAAAUAGC AAGUUAAAAUAAGGCUAGUC CGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGCUUUU-3’

[1218] 5'-CCAUCGACAAGAAAGGGACUGA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention features compositions and methods for editing deleterious mutations associated with alpha-1 anti-trypsin (A1AT) deficiency. In particular embodiments, the invention provides methods for correcting mutations in an A1AT polynucleotide using an adenosine deaminase base editor, ABE8, having unprecedented levels of efficiency.

Description

[0001] Cross References to Related Applications [0002] This application is an international PCT application asserting U.S. Provisional Application No. 62 / 805,238 filed February 13, 2019; U.S. Provisional Application No. 62 / 805,271 filed February 13, 2019; U.S. Provisional Application No. 62 / 852,224; U.S. Provisional Application No. 62 / 852,228 filed May 23, 2019; U.S. Provisional Application No. 62 / 931,722 filed November 6, 2019; U.S. Provisional Application No. 62 / 931,722 filed November 27, 2019 Application No. 62 / 941,569; and the priority of U.S. Provisional Application No. 62 / 966,526, filed January 27, 2020, the contents of all of which are incorporated herein by reference. [0003] incorporated by reference [0004] All publications, patents and patent applications mentioned herein are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by referenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00C12N9/22C12N9/78C12N15/10
CPCC12N15/11C12N15/90C12N2310/20C12N2320/34C07K14/8125C12N9/78C12Y305/04004C12N9/22C12N15/102C12N5/067A61K31/7105C07K2319/80C12N2510/00A61K31/7088A61K35/407A61K38/465A61K48/0025
Inventor N·戈代尔利M·帕克B·蔡澈I·斯雷梅克Y·于D·A·玻恩S-J·李
Owner BEAM THERAPEUTICS INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com