Method for detecting bactrocera dorsalis based on visual LAMP (loop-mediated isothermal amplification) technology and application

A technology of Bactrocera dorsalis and reaction, applied in the field of detection of Bacteralis dorsalis based on visual LAMP technology, can solve the problems that Bacteralis dorsalis cannot be detected, and achieve the goal of avoiding aerosol pollution, simple result detection and high sensitivity Effect

Pending Publication Date: 2022-03-04
QINGDAO AGRI UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although a Chinese patent application with the application number 201711141240.3 discloses a rapid visualization method for molecular detection of Bacteralis melons, this patent uses LAMP technology to identify Bacteralis melons, and cannot be used for Bactrocera dorsalis detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting bactrocera dorsalis based on visual LAMP (loop-mediated isothermal amplification) technology and application
  • Method for detecting bactrocera dorsalis based on visual LAMP (loop-mediated isothermal amplification) technology and application
  • Method for detecting bactrocera dorsalis based on visual LAMP (loop-mediated isothermal amplification) technology and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Primer Design

[0034] Based on a 633bp fragment (SEQ ID NO: 1) on the Bacteralis dorsalis mitochondrial COI gene. The sequence is as follows:

[0035] SEQ ID NO: 1:

[0036]TGAGCAGGAATAGTAGGAACATCCCTTAGAATTTTAGTCCG AGCTGAACTCGGTCACCCAGGAGCTTTAATCGGTGACGATCAA ATTTATAATGTAATTGTAACAGCTCATGCTTTCGTAATAATTTTCT TTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGACTTGT TCCTTTAATATTAGGAGCTCCCGATATAGCATTTCCACGAATGAA TAATATAAGATTTTGATTATTACCTCCTTCCCTTACATTACTATTAG TAAGAAGTATAGTAGAAAACGGAGCTGGTACAGGTTGAACAGT TTACCCACCCCTATCATCTGTTATTGCACACGGAGGAGCTTCAG TTGACCTAGCTATTTTTTCACTTCACTTAGCGGGTATTTCCTCAA TTTTAGGAGCAGTAAATTTCATTACAACAGTAATTAATATACGAT CGACAGGAATCACCTTTGATCGAATACCTCTATTCGTTTGAGCA GTTGTATTAACAGCTTTATTACTTTTATTATCATTACCAGTTTTAG CGGGGGCTATTACTATACTACTAACAGACCGAAACTTAAATACTT CCTTTTTTGACCCTGCTGGAGGAGGAGATCCTATTCTTTACCAA CATTTATTT

[0037] 1426 sequences at the same position of 73 species of Bactrocera downloaded from NCBI database were compared. Record the variable sites with h...

Embodiment 2

[0048] The effectiveness detection of embodiment 2 primers

[0049] The LAMP reaction was carried out on the populations of Bacteralis dorsalis collected in multiple regions. Since there is a certain variation in the genetic information of B. dorsalis individuals from different regions, if the primers can be successfully amplified on the target individuals, it means that Primer works. The fruit fly caught by the trap monitoring and trapping was used as the detection object (Table 1). All tested insects were verified by adult morphological identification (identification verification after raising larvae to adults) and DNA barcode identification.

[0050] The LAMP reaction detection steps are as follows:

[0051] a) Take the whole body or part of the tissue sample of the insect to be tested, and use the DNeasy Blood & Tissue kit (QIAGEN) to extract genomic DNA by referring to the instructions of the kit.

[0052] b) Utilize two pairs of specific amplification primers: FIP / BIP...

Embodiment 3

[0065] Embodiment 3 specific detection

[0066] The specificity of the LAMP primers was verified by testing different species of fruit flies. Insects other than Bactrocera dorsalis are shown in Table 2. All samples have been sequenced and compared to ensure that the species identification is correct. Deionized water was used as a blank control instead of DNA template.

[0067] Table 2 Insects other than Bactrocera dorsalis

[0068]

[0069] Figure 4 One of the reaction results is selected for sampling for electrophoresis detection results, such as Figure 4 As shown, Bactrocera dorsalis was successfully amplified, while other fruit flies were not amplified, which was in line with expectations.

[0070] Figure 5 The results of fluorescent color development are as follows: from left to right, they are numbered 1-4 Bactrocera dorsalis 5-8 Bactrocera dorsalis 9-12 Bactrocera squash 13-15 blank control. From the results, the primers are highly specific.

[0071] Imag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting bactrocera dorsalis based on a visual LAMP (loop-mediated isothermal amplification) technology, which comprises the following steps: 1) designing a specific LAMP primer group by taking a section containing a polymorphic variation site in a bactrocera dorsalis mitochondrial COI gene as a target gene; (2) carrying out LAMP reaction by using the specific LAMP primer group and taking the whole genome DNA of a sample to be detected as a substrate; and 3) after the LAMP reaction is finished, judging whether the sample to be detected is the bactrocera dorsalis or not according to the color development result of the nucleic acid dye for detection. The invention also provides a corresponding primer group and application thereof. The method and the primer group provided by the invention can accurately detect bactrocera dorsalis in 73 species of bactrocera, have high sensitivity, and can be used for visual rapid detection of a detected material in biological quarantine.

Description

technical field [0001] The invention relates to the technical field of biological quarantine, in particular to a method and application for detecting Bactrocera dorsalis based on visual LAMP technology. Background technique [0002] Many species of Tephritidae have important economic impacts, not only causing heavy losses to the production of fruits and vegetables in the areas where they occur, but also seriously affecting the export trade of fruits and vegetables in my country. Bactrocera dorsalis belongs to the family Tephritidae (order Diptera) and is widely distributed in tropical temperate regions of southern Asia, southeastern Asia and the South Pacific. According to existing reports, Bactrocera dorsalis produces damage to the fruits of more than 250 kinds of plants in 46 families, and there are more types of fruits and vegetables that have not yet been reported to actually cause damage. Due to its great harm and its easy long-distance spread with the transfer of host...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6888C12Q1/6844C12Q2600/156C12Q2531/119
Inventor董兆克褚栋刘利君
OwnerQINGDAO AGRI UNIV