Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

61results about How to "Solve difficult to identify" patented technology

Underlined text image preprocessing method and device

The invention discloses an underlined text image preprocessing method and device, relating to the field of optical character recognition. The method comprises the following steps: acquiring the position of each text line in a text image; for the position of each text line, searching each text line based on a run-length search method; if the preliminary determination result shows that an underline exists in the text line, locating the position of the initial upper boundary of the underline; by using the initial upper boundary of the underline as an initial pixel line, locating the underline region based on run-length search and connected domain analysis methods; separating out stroke regions of characters from the underline region, thus obtaining a region to be deleted; and setting the foreground information in the region to be deleted into the background, thus obtaining a character region having no underline. By searching each text line based on the run-length search method for the position of each text line, the invention solves the problem that a text having an underline (especially an underline conglutinated with characters) is difficult to recognize, improves the character recognition rate, and enhances the adaptability of the recognition core.
Owner:HANVON CORP

Method for manufacturing black matrix

The invention provides a method for manufacturing a black matrix. A substrate is coated with a black matrix light resistance system containing positive photoresist, a light resistance layer formed by the black matrix light resistance system undergoes twice different exposure and developing processes by utilizing the characteristics that the positive photoresist can be removed by developing liquid in a developing process in an area irradiated by UV (Ultraviolet) rays, and thus the problem that alignment marks are difficult to identify after the black matrix light resistance system is coated in a BOA (Black matrix On Array) procedure is solved.
Owner:TCL CHINA STAR OPTOELECTRONICS TECH CO LTD

Method for testing and identifying dynamic characteristic coefficients of sliding bearing

ActiveCN102928222AOvercoming disadvantages not suitable for large bearingsSimple methodMachine bearings testingLubrication theoryEngineering
The invention discloses a method for testing and identifying dynamic characteristic coefficients of a sliding bearing. The method comprises the following steps of: (1) fixing a bearing to be identified on a test bed; (2) arranging a key phase mark which serves as a reference for subsequent rotational speed analysis and key-phase synchronous acquisition analysis on a shaft segment of a rotation shaft, wherein the shaft segment of the rotation shaft is the part, which is positioned between the bearing and a power input end of a rotation shaft, of the rotation shaft; (3) applying unbalanced force which serves exciting force to the shaft segment of the rotation shaft; (4) raising the speed of the rotation shaft up to the test speed, and respectively measuring a dynamic strain signal of the shaft segment of the rotation shaft and the vibration displacement of the rotation shaft relative to the bearing; (5) computing the dynamic load which is born by the bearing according to the dynamic strain signal of the shaft segment of the rotation shaft; (6) substituting the dynamic load of the bearing and the vibration displacement of the rotation shaft into a computational formula corresponding to the lubrication theory of the bearing to obtain two sets of solving equations; (7) changing the unbalanced force to obtain another two sets of solving equations; and (8) solving the four sets of solving equations to obtain the dynamic characteristic coefficients of the bearing. By the method, large-sized bearings can be tested, large-sized equipment such as a vibration exciter is not required, and the identification result is accurate.
Owner:GUANGDONG ELECTRIC POWER SCI RES INST ENERGY TECH CO LTD

Application of brucellosis A19 molecular marking vaccine and immunological identification thereof

The invention relates to an application of brucellosis A19 molecular marking vaccine and immunological identification of the brucellosis A19 molecular marking vaccine. The brucellosis vaccine can be applied to an enzyme-linked immunosordent assay (iELISA) method to distinguish an animal inoculated with the vaccine from a wild virus infected animal. According to the invention, a cattle is used as a test target animal antiepidemic to the brucellosis, the cattle is immune to brucellosis A19-detlaVirB12 marking vaccine so as to evaluate the immunological protection of the molecular marking vaccine. An iELISA method for distinguishing the brucellosis A19-detlaVirB12 immune animal from the wild virus infected animal is created. The brucellosis A19-detlaVirB12 marking vaccine provided by the invention not only has good immunological protection against the cattle brucellosis, and the iELISA method provided by the invention solves the problem that the immune animal is difficult to be distinguished from the clinic diseased animal, and the brucellosis A19 molecular marking vaccine has an actual application value in prevention and control, elimination and purification of the cattle brucellosis.
Owner:新疆维吾尔自治区畜牧科学院兽医研究所

Method for judging negatively-damped oscillation and forced oscillation on basis of straight line method

The invention provides a method for judging negatively-damped oscillation and forced oscillation on the basis of a straight line method. The method comprises the steps: (1) acquiring an actually-measured oscillation curve; (2) selecting the maximum moment point in each oscillation period for analysis; (3) confirming the oscillation as increasing oscillation; (4) selecting two points, the spacing of which is greater than four oscillation periods, to form a linear equation; and (5) calculating difference to numerical values on the straight line and the actually-measured curve at the same one time point one by one, and judging the type of oscillation according to the obtained result. According to the method for judging negatively-damped oscillation and forced oscillation on the basis of the straight line method, through the data of a PMU (Power Management Unit) or a WAMS (Wide Area Measurement System), that certain low-frequency oscillation is of low-frequency negatively-damped oscillation caused due to damp lack of the system, or the forced oscillation caused due to a forced disturbance source existing in the system can be judged so as to fast take measures to restrain the low-frequency oscillation.
Owner:CHINA ELECTRIC POWER RES INST +1

Human-machine cooperative picking robot based on Leap Motion and machine vision and control method thereof

The invention discloses a human-machine cooperative picking robot based on Leap Motion and machine vision and a control method thereof. The human-machine cooperative picking robot comprises a walkingmechanism and a picking mechanical arm. A power source, a picking collecting basket and a robot controller are fixedly arranged on the walking mechanism, and the picking mechanical arm is arranged onthe walking mechanism. A picking mechanical hand is arranged on the picking mechanical arm. The human-machine cooperative picking robot also comprises a remote control system, and the remote control system comprises a computer and a Leap Motion somatosensory sensor, the Leap Motion somatosensory sensor communicates with the computer, and the computer communicates with the robot controller. A camera is arranged on the picking mechanical hand and communicates with the robot controller, and the camera and the robot controller are electrically connected with the power source. The human-machine cooperative picking robot can recognize objects to be picked in a complex background environment by using the excellent visual system of a human and is remotely controlled to move to pick fruits by the non-contact somatosensory sensor.
Owner:SOUTHWEST UNIVERSITY

Method for distinguishing negative damping low frequency oscillation on the basis of moment decomposition integral algorithm

The invention belongs to the field of power systems, in particular relates to a method for distinguishing negative damping low frequency oscillation caused by a power generator excitation control system on the basis of moment decomposition integral algorithm. The method comprises the steps of: calculating a power generator transient state potential bias deltaE'q and determining a power generator speed bias delta omega, wherein the power generator speed bias delta omega is obtained through calculation according to a frequency of a potential EQ in a power generator, and whether damp provided by an excitation system of the unit is positive or negative relative to some oscillation mode in an Internet power grid is judged through calculating an integral value of the power generator transient state potential bias deltaE'q and the power generator speed bias delta omega. The method is convenient for measurement and is accurate, and can simply and clearly distinguish which oscillation mode of some power generator excitation control system provides a positive damp or negative damp so that measures are rapidly taken for inhibiting low frequency oscillation.
Owner:CHINA ELECTRIC POWER RES INST +1

Identification method and identification system for anti-counterfeiting information of certificate

The invention relates to the field of information security authentication, in particular to an identification method and identification system for anti-counterfeiting information of a certificate, andthe identification method comprises the steps: obtaining a certificate image containing the anti-counterfeiting information; correcting and segmenting the certificate image to obtain a plurality of anti-counterfeiting areas, identifying the plurality of anti-counterfeiting areas respectively, and outputting identification results corresponding to the anti-counterfeiting areas in sequence; and judging the authenticity of the certificate image in combination with the identification result corresponding to each anti-counterfeiting area. The identification method has the advantages that the detection of the anti-counterfeiting information is comprehensive, the anti-counterfeiting detection of various certificates can be covered, the efficiency and the accuracy are higher compared with the traditional mode, and the safety is integrally improved.
Owner:HUAZHONG UNIV OF SCI & TECH

Method for identifying negative damping low-frequency oscillation based on force moment decomposition method

The invention belongs to the filed of electric systems, in particular relating to a realizing method of identifying negative damping low-frequency oscillation which is caused by a generator excitation control system, based on a force moment decomposition method. The realizing method comprises the following steps of: calculating subtranient electric potential E'q of a generator and determining velocity deviation delta omega of the generator, wherein the velocity deviation delta omega of the generator is calculated according to frequency of inner electric potential EQ of the generator; and judging whether damping provided by the excitation system of a machine group for a certain oscillation mode in an interconnected power grid is positive or negative by comparing phase relation of the subtranient electric potential delta E'q of the generator and the velocity deviation delta omega of the generator. The realizing method disclosed by the invention is convenient to measure, is accurate, can simply and clearly identify the generator excitation control system which provides the negative damping for a certain negative damping oscillation mode so as to quickly inhibit low-frequency oscillation. The method is a pioneering at home.
Owner:CHINA ELECTRIC POWER RES INST +1

Automatic correction system and method for simple answers

The invention relates to an automatic correction system for simple answers, which is characterized by comprising a text analysis and labeling module, a similarity comparison module and a similarity scoring module, and a client comprises a user input answer text, a user labeling word pair and a display result. According to the method, deep semantic analysis can be realized without depending on a knowledge base, and the similarity of answer texts is obtained by using an optimized word comparison method.
Owner:BEIJING FORESTRY UNIVERSITY

Method and system for identifying group users

The invention discloses a method and a system for identifying group users, and the method comprises the following steps: after the gateway GPRS supporting node (GGSN) receives an address pool name transmitted by remote authentication dial in user service (RADIUS), the received address pool name is compared with the group user session address pool allocated locally, if the received address pool name is consistent with the address pool address of some group user session assigned locally, the user is determined as one group user and is added in the group user session. By adopting the technical scheme provided by the invention, the problem of difficult identifying group users is solved better, the consistency of the address used by the same group user session is realized, thus facilitating inner communication and saving network resources.
Owner:ZTE CORP

DEM-based automatic identification and boundary extraction method of moon surface impact crater

The invention discloses a DEM-based automatic identification and boundary extraction method of a moon surface impact crater. The method comprises the following steps that 1, catchment analysis is conducted on a moon surface DEM elevation domain, and catchment dividing and generating are conducted; 2, spatial alternation is conducted on the DEM elevation domain, and the processed moon surface elevation domain is changed to an artificial terrain domain to be used for identifying sunken areas of different sizes; 3, edge expanding is conducted on the sunken areas through a neighborhood expansion algorithm, and a complete impact crater area is obtained; 4, the boundary of the impact crater area is fitted through the Fourier Series, and the precise shape of the impact crater is extracted. The problem that the complex moon surface is complex due to the overlaying impact craters and is difficult to identify completely is solved, the integrity of the identifying result is guaranteed, the boundary of the impact crater object is fitted through the Fourier Series, and the actual shape parameter of the crater is extracted, and accuracy of the extraction result is guaranteed.
Owner:SHANDONG UNIV

EOF-based unmanned aerial vehicle signal identification system and method

According to an EOF-based unmanned aerial vehicle signal identification system and method provided by the invention, the problem that similar unmanned aerial vehicle signals are difficult to identifyis solved, the identification effect of unmanned aerial vehicles with similar signals can be effectively improved, and better support is provided for unmanned aerial vehicle identification managementand control. The method provided by the invention comprises the following steps: 1) firstly, carrying out preliminary identification on a received unmanned aerial vehicle signal through a characteristic parameter matching method; 2) carrying out FFT (Fast Fourier Transform) processing on the unmanned aerial vehicle signal which cannot be recognized through characteristic parameter matching, and then generating a corresponding time-frequency analysis graph; 3) adopting an empirical orthogonal function analysis method to decompose a video analysis matrix corresponding to the video analysis graphinto an EOF matrix reflecting signal common characteristics and a characteristic coefficient matrix reflecting signal difference characteristics; and 4) performing feature data extraction and BP neural network training on the feature coefficient matrix, constructing a corresponding unmanned aerial vehicle type classifier, and outputting an identification result.
Owner:湖南坤雷科技有限公司

Building test block and management system thereof

InactiveCN101118708ANot easy to fall offRealize the whole process information managementStampsIdentification meansManagement systemTest management
The present invention discloses an architecture test block, and a test block information sign board integrated with the test block body is solidificated on the surface of the test block body. The test block information sign in the present invention cannot be exfoliated and tampered but can be fixed permanently, thus being convenient to perform the whole process retrospective management of the course information. The present invention also provides an architecture test block information management system, comprising a test block provided with a information sign board, and the information sign of the test block is applied to track management of the test block; and a test block information management system software is applied for managing the course information materials of the test block, and the test block information management system software can implement the whole process retrospective management on the architecture test block and inhibit the problem of the false test block. The present invention resolves the problem that the false test block is sent to the inspection institute to be detected with the false to be the genuine, and the identification thereof is difficult, and the overspread of the phenomenon of the false test block is inhabited.
Owner:史志锋

Method for establishing identification database of imported iron ore origins

The invention relates to a method for establishing an identification database of imported iron ore origins, comprising the following steps: 1, grinding and drying an imported iron ore sample and pressing the ground and dried imported iron ore sample into a testing sample piece; 2, placing the testing sample piece into an X-ray fluorescence spectrometer to measure the element content; 3, establishing a database of component contents of the imported iron ore; 4, utilizing a mathematical statistics method to establish a 'digital hologram', determining elements which are most influential to identification and establishing an identification database; and 5, after statistic analysis, determining that five elements including calcium, magnesium, aluminum, copper and vanadium are most influential to identification, simplifying data of the component contents of the imported iron ore, and finally establishing the identification database of the imported iron ore origins. By adopting the identification database of the imported iron ore origins established by the invention, the problem of hard identification of the imported iron ore origins is solved, thus the imported iron ore origins can be identified rapidly and accurately, trade fraud performed by foreign iron ore traders can be prevented and the benefits of domestic users and the country are protected.
Owner:CHEM MINERALS & METALLIC MATERIALS INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

System and method for judging negative damped oscillation and forced oscillation based on straight line method

The invention provides a system and method for judging negative damped oscillation and forced oscillation based on a straight line method. Through data of a PMU ((Power Management Unit) or WAMS (Wide Area Measurement System), an electromechanical quantity which is close to the stability of a power system is selected, whether certain low-frequency oscillation is a negative damped low-frequency oscillation caused by damping insufficiency or a forced oscillation caused by a forced disturbance source existing in a system can be rapidly recognized within scores of initial cycles, so that a measure for inhibiting low frequency oscillation is rapidly taken.
Owner:CHINA ELECTRIC POWER RES INST +1

Plane structural part rib characteristic identification method

The invention discloses a plane structural part rib characteristic identification method, and belongs to the technical fields of computer-aided design (CAD) / computer-aided process planning (CAPP) / computer-aided manufacturing (CAM). The method is composed of five mainly procedures which are identification pretreatment, horizontal rib top surface extraction, constraint geometric surface extraction, split node construction and rib characteristic extraction. The method can effectively achieve automatic extraction of rib characteristics of a plane structural part, and is high in the identification rate and efficiency. When the crossed rib characteristic identification is processed by the method, the purpose that time consumption caused by deceleration of a machine tool during processing of the rib characteristics is achieved, and the identification result can improve processing efficiency. When the method is used for numerical control programming based on the characteristics, high programming efficiency and high programming quality can be obtained, and good application prospect is achieved.
Owner:NANJING UNIV OF AERONAUTICS & ASTRONAUTICS

Method for identifying particle shoal facies of carbonate rocks

The invention provides a method for identifying particle shoal facies of carbonate rocks. The method comprises that logging data and sedimentary facies types of a reference well location in differentwell depths within a reference section are obtained; the logging data and sedimentary facies types of the reference well location in different well depths within the reference section are analyzed todetermine a sedimentary facies type discriminating formula; and according to the sedimentary facies type discriminating formula and the obtained logging data of the reference well location in different well depths within the reference section, sedimentary facies types of a to-be-measured well location in different well depths within the reference section are determined. The logging data comprisesnatural Gamma logging GR data, sound wave time difference logging AC data and stratum real resistivity RT data; and the sedimentary facies types include a particle shoal facies and a non-particle shoal facies. Via technical schemes provided by the invention, the problem that the particle shoal facies of a log without rock core and field outcrop data is hard to identify is solved, and the particleshoal facies of a work area in relatively large scale can be identified much more efficiently.
Owner:PETROCHINA CO LTD

Method for predicting reservoir for middle and small-sized glutenite bodies

The invention relates to a method for predicting a reservoir for middle and small-sized glutenite bodies. According to the invention, the method includes the following steps: firstly analyzing the seismic data of an area under research, selecting an area which have poor continuity of linups, hard-to-track seismic horizons, and explicitly differences in steady reflection from the periphery; then using the chaotic technology to detect the irregular attributes of a region having poor imaging in the area to obtain a chaotic body data body, superposing the chaotic body data body with the original seismic data of the region to form a superposed display image of the chaotic body and a seismic body; displaying the chaotic body data in 3 dimensional image which locates a seismic abnormal body through perspective; finally based on the 3 dimensional image displayed and the superposed cross section of the chaotic body, conducting analysis in combination with the drilling data of the area under research, explaining the result in terms of geology, and determining the advantageous position of oil gas. Through the aforementioned process, according to the invention, the method can better demonstrate the spatial changes of lithologic and lithic facies of the glutenite bodies, and provide another strong means for the description of the reservoir.
Owner:CHINA PETROLEUM & CHEM CORP +1

Fine identification method for sedimentary elements of waterway complex based on spectral decomposition and coherent attribute fusion process

The invention discloses a fine identification method for the sedimentary elements of a waterway complex based on spectral decomposition and a coherent attribute fusion process, comprising the following steps: (1) making frequency analysis of a data volume; (2) forming a tuned data volume; (3) establishing discrete time-frequency volumes; (4) carrying out coherent volume operation; (5) carrying outvolume fusion operation: carrying out superposed and fused display of the discrete time-frequency volumes corresponding to different sedimentary elements obtained in step (3) and the coherent volumesin step (4) to obtain coherent time-frequency volumes corresponding to different sedimentary elements; and (6) visually displaying the coherent time-frequency volumes by using an isochronal slicing or stratigraphic slicing technology, and reconstructing the vertical evolution process and planar distribution characteristics of single sedimentary elements of a target waterway complex to finely identify the sedimentary elements. Technical problems as follows are solved: the distribution of sand bodies of a deep-water complex waterway is complex; it is difficult to describe the sedimentary elements; it is difficult to identify the development phase of the waterway; and the resolution of seismic data is inadequate to predict the high-quality reservoir sand bodies in the complex waterway.
Owner:CHINA NAT OFFSHORE OIL CORP +1

Immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine

The invention discloses an immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine. The method comprises the following steps: a, carrying out bioinformatics software analysis according to the VirB12 gene characteristics of Brucella A19, so as to obtain an active sequence, wherein the corresponding DNA sequence is a polypeptide 074 DNA sequence: GGCCTGACGGACAACAACTGCCCTCCTCCCGGTGATACGTACGCAA; b, conducting artificial synthesis on the sequence obtained in the step a by taking the DNA sequence as a template, so as to obtain polypeptide, wherein the amino acid sequence of the polypeptide is a polypeptide 074 amino acid sequence: GLTDNNCPPPGDTQ; c, taking the active polypeptide ingredient obtained in the step b as an envelope antigen. According to the method, the problem that an immune animal and a clinic sick animal are difficult to identify is solved, and the practical application value in preventing, controlling, eliminating and purifying cattle brucellosis is high.
Owner:VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI

Unstructured feature differentiation method based on multi-intelligence fusion

InactiveCN108226053AEffective identification of basic taste sensationsEffective identification of bad taste maskingImage enhancementImage analysisBiologyMachine learning
The invention relates to the technical field of automation, and discloses an unstructured feature differentiation method based on multi-intelligence fusion which is used for identifying properties oftraditional Chinese medicines. By combining an super-large-scale feedback type neural network mode intelligent identification system, an array type intelligent signal extraction system and a multi-channel intelligent complex ingredient identification system, the method can simultaneously effectively extract color features, size features, texture features, odor features and taste features of traditional Chinese medicines and comprehensively analyze the features, so that the specifications and grades of the traditional Chinese medicines can be accurately differentiated.
Owner:NANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE

Method for detecting bactrocera dorsalis based on visual LAMP (loop-mediated isothermal amplification) technology and application

The invention provides a method for detecting bactrocera dorsalis based on a visual LAMP (loop-mediated isothermal amplification) technology, which comprises the following steps: 1) designing a specific LAMP primer group by taking a section containing a polymorphic variation site in a bactrocera dorsalis mitochondrial COI gene as a target gene; (2) carrying out LAMP reaction by using the specific LAMP primer group and taking the whole genome DNA of a sample to be detected as a substrate; and 3) after the LAMP reaction is finished, judging whether the sample to be detected is the bactrocera dorsalis or not according to the color development result of the nucleic acid dye for detection. The invention also provides a corresponding primer group and application thereof. The method and the primer group provided by the invention can accurately detect bactrocera dorsalis in 73 species of bactrocera, have high sensitivity, and can be used for visual rapid detection of a detected material in biological quarantine.
Owner:QINGDAO AGRI UNIV

Infrared image stripe filtering method based on image laying

The invention discloses an infrared image stripe filtering method based on image laying and the method comprises the following steps: 1) dividing an infrared image into a smooth layer image (S) and a noise layer image (N); 2) applying one-dimensional local median filtering to each row of the noise layer image to obtain a pre-processed noise layer image N_O; 3) calculating the average value avg_n1 of the rows in the pre-processed noise layer image N_O; and 4) removing the average value avg_n1 of the rows in the pre-processed noise layer image N_O from the infrared image. In the invention, an image is divided into a smooth layer image and a noise layer image, so that stripe noise is kept in the noise layer image, and only the noise layer image has to be processed, which means that even when the image changes, stripe noise can still be recognized, and that the noise layer image raises its success rate for judgment without introducing new noise.
Owner:JING LIN CHENGDU SCI & TECH

Linear-scanning-based method for improving recognition capability of thin interbed

The invention provides a linear-scanning-based method for improving the recognition capability of a thin interbed. The method comprises: carrying out spectrum and waveform characteristic analysis on seismic data to obtain a dominant frequency band range and phase information of the seismic data; extracting wavelets of all seismic data by using the complex cepstrum and adjusting obtained wavelet frequency bands and phases; with broadband information of a linear scan signal, sliding a time window and selecting an optimal linear scanning wavelet ; for a single-track record, carrying out wavelet shaping deconvolution by extracting the wavelet and optimal linear scanning wavelet to obtain a shaping operator of a target track; and acquiring a new high-resolution seismic record by using a new composite shaping operator and target seismic recording track convolution. According to the invention, high-precision processing is carried out on the thin layer and thin interbed; according to the broadband characteristics of linear scanning wavelets, bandwidth compensation is reasonably carried out, so that the main frequency is increased and the frequency band range is extended; a high-resolutionseismic profile is obtained; and the recognition ability of the thin layer is improved effectively.
Owner:CHINA PETROLEUM & CHEM CORP +1

Pseudo base station identification method and device and computer readable storage medium

The invention discloses a pseudo base station identification method, device, equipment and a computer readable storage medium. The pseudo base station recognition method comprises the following steps:obtaining cell information delivered by the corresponding cell base station when an access instruction for a terminal to access a cell base station is detected; determining whether the cell information comprises public land mobile network information prohibited by a subscriber identity module (SIM) of the terminal; and prohibiting the terminal from accessing the cell base station when the cell information comprises the public land mobile network information prohibited by the SIM of the terminal. The invention aims to solve the technical problem that the pseudo base station is difficult to recognize in the prior art, which affected the social, work, and money usage of the user, and the user experience is low.
Owner:ZTE CORP

A dem-based method for automatic identification and boundary extraction of lunar impact craters

The invention discloses a DEM-based automatic identification and boundary extraction method of a moon surface impact crater. The method comprises the following steps that 1, catchment analysis is conducted on a moon surface DEM elevation domain, and catchment dividing and generating are conducted; 2, spatial alternation is conducted on the DEM elevation domain, and the processed moon surface elevation domain is changed to an artificial terrain domain to be used for identifying sunken areas of different sizes; 3, edge expanding is conducted on the sunken areas through a neighborhood expansion algorithm, and a complete impact crater area is obtained; 4, the boundary of the impact crater area is fitted through the Fourier Series, and the precise shape of the impact crater is extracted. The problem that the complex moon surface is complex due to the overlaying impact craters and is difficult to identify completely is solved, the integrity of the identifying result is guaranteed, the boundary of the impact crater object is fitted through the Fourier Series, and the actual shape parameter of the crater is extracted, and accuracy of the extraction result is guaranteed.
Owner:SHANDONG UNIV

Character string matching library acquired network flow service analysis method and device

The invention provides a character string matching library acquisition method and device. The character string matching library acquisition method comprises the following steps: acquiring historical internet surfing flow information of an internet user; analyzing each piece of historical Internet surfing flow information of the user to obtain a first historical character string set, the first historical character string set comprising a first historical character string; merging the same first historical character strings in the first historical character string set, and adding the merged first historical character strings by using traffic to obtain a second historical character string set, the second historical character string set comprising a second historical character string; rankingthe obtained second historical character string according to the flow size; analyzing a service corresponding to the second historical character string; marking the business corresponding to the second historical character string on the second historical character string to generate a third historical character string set; and taking the third historical character string set as a character stringmatching library. The invention provides a network traffic service analysis method and a network traffic service analysis device, which are used for quickly identifying a specific service corresponding to user traffic information.
Owner:北京浩瀚深度信息技术股份有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More