Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine

A technology for molecularly labeling vaccines and brucellosis, applied in scientific instruments, analytical materials, biological material analysis, etc., can solve the problems of difficult identification of immunized animals and clinically diseased animals, achieve good immune protection, and solve difficult problems The effect of discrimination

Inactive Publication Date: 2016-06-01
VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is: provide a kind of brucellosis A19-ΔVirB12 molecular marker vaccine immunological identification method, solve the problem that immunization animal and clinical sick animal are difficult to distinguish, to bovine brucellosis Prevention and control, eradication and purification have practical application value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine
  • Immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine
  • Immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Immunological identification of brucellosis A19 molecular marker vaccine:

[0021] Preparation of active peptide ingredients:

[0022] The VirB12 gene sequence was analyzed with bioinformatics software to obtain the predicted active site, and the predicted active site DNA sequence was used as a template to artificially synthesize active polypeptide components, which were used as ELISA coated antigens for detection.

Embodiment 2

[0024] iELISA identification of A19-ΔVirB12 vaccine antibody and field strain antibody:

[0025] Experimental materials and equipment: Danish NUNC enzyme-labeled 96-well reaction plate, rabbit anti-bovine IgG horseradish peroxidase (USA, Bethyl Company), microplate reader (Bio-Rad680), micropipette (10-1000μL).

[0026] Reagent and solution formula:

[0027] Coating diluent (0.05mol / L sodium carbonate-sodium bicarbonate buffer, pH9.6): Na 2 CO 3 1.5g, NaHCO 3 2.9g, Na 2 N 3 0.2g, add deionized water to 1000ml, adjust to pH=9.6.

[0028] Washing solution (PBST, pH7.4): NaCl8.0g, KH 2 PO 4 0.2g,NaHPO 4 12H 2 O2.9g, KCl0.2g, Tween200.5ml, add deionized water to 1000ml, adjust to pH7.4.

[0029] Sample diluent: 1×PBS1000mL, Tween205mL, fish skin glue 30g (pH7.4).

[0030] Enzyme-labeled secondary antibody: rabbit anti-bovine IgG horseradish peroxidase.

[0031] Substrate chromogenic solution: 1ml citric acid solution, 20μL TMB (3,3',5,5'-tetramethylbenzidine) solution ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine. The method comprises the following steps: a, carrying out bioinformatics software analysis according to the VirB12 gene characteristics of Brucella A19, so as to obtain an active sequence, wherein the corresponding DNA sequence is a polypeptide 074 DNA sequence: GGCCTGACGGACAACAACTGCCCTCCTCCCGGTGATACGTACGCAA; b, conducting artificial synthesis on the sequence obtained in the step a by taking the DNA sequence as a template, so as to obtain polypeptide, wherein the amino acid sequence of the polypeptide is a polypeptide 074 amino acid sequence: GLTDNNCPPPGDTQ; c, taking the active polypeptide ingredient obtained in the step b as an envelope antigen. According to the method, the problem that an immune animal and a clinic sick animal are difficult to identify is solved, and the practical application value in preventing, controlling, eliminating and purifying cattle brucellosis is high.

Description

technical field [0001] The invention relates to the technical field of veterinary biological products, in particular to an immunological identification method of a brucellosis A19-ΔVirB12 molecular marker vaccine. Background technique [0002] Brucellosis (Brucellosis) is caused by Brucella (Brucella) widespread zoonotic infectious diseases around the world. The prevention and eradication of brucellosis has become the main task of public health security defense systems in many countries and regions. [0003] In most countries and regions where brucellosis is endemic, the main means of controlling livestock brucellosis is still to use vaccination for immunization. Therefore, vaccination is the main measure and the most effective means to prevent and control livestock brucellosis. At present, the attenuated bacterial vaccines used in my country include bovine A19, sheep M5 and pig S2; the attenuated bacterial vaccines used abroad include bovine S19 and RB51, and sheep Rev1; S...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68G01N33/569
CPCG01N33/56911G01N33/68G01N2333/23
Inventor 钟旗叶锋马晓菁易新萍姚刚谷文喜吐尔洪·努尔马俊杰
Owner VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com