Porcine epidemic diarrhea virus fusion protein as well as coding gene and application thereof

A porcine epidemic diarrhea and epidemic diarrhea technology, applied in the field of biotechnology, can solve the problems of infection, virus strain variation, poor effect, etc., and achieve the effect of good safety and high immune titer

Active Publication Date: 2022-04-26
长沙爱科博生物科技有限公司
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Classic strain live vaccines are safe but not effective. There is not enough data to support whether the use of new strain live vaccines is likely to cause strain mutation and detoxification to cause wider infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine epidemic diarrhea virus fusion protein as well as coding gene and application thereof
  • Porcine epidemic diarrhea virus fusion protein as well as coding gene and application thereof
  • Porcine epidemic diarrhea virus fusion protein as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0050] In some more specific embodiments, the preparation method of the recombinant vector comprises the following steps:

[0051] (1) artificially synthesize the fusion gene CTLA4-PEDVS of porcine CTLA4 gene and porcine epidemic diarrhea virus S gene (nucleotide sequence shown in SEQ ID NO.3);

[0052] (2) Subcloning the fusion gene CTLA4-PEDVS synthesized in step (1) onto the adenovirus shuttle vector plasmid P to obtain the adenovirus shuttle plasmid p-CTLA4-PEDVS;

[0053] (3) co-transfecting host cells with the adenovirus shuttle plasmid p-CTLA4-PEDVS obtained in step (2) and the adenovirus packaging vector;

[0054] (4) Collect the cell culture supernatant and the cell pellet lysate supernatant to obtain the crude extract of CTLA4-PEDVS recombinant adenovirus.

[0055] Specifically, in step (2), the adenovirus shuttle vector plasmid is pDC316.

[0056] Specifically, in step (3), the adenovirus packaging vector is pBHGlox(delta)E13Cre.

[0057] Specifically, in step (3...

Embodiment 1

[0059] Example 1 Construction and protein expression of pDC316-CTLA4-PEDVS and pDC316-PEDVS plasmids

[0060] 1.1 Fusion gene

[0061] (1) artificially synthesized porcine CTLA4 gene and porcine epidemic diarrhea virus S gene (the nucleotide sequence is shown in SEQ ID NO.3, using the fragment of the 450-890th amino acid in the conserved region of the strain S gene) fusion gene CTLA4- PEDVS; synthetic CTLA4-PEDVS fusion gene (as shown in SEQ ID NO.1);

[0062] (2) artificially synthesize the fusion gene CTLA4-PEDVS-1 of porcine CTLA4 gene and porcine epidemic diarrhea virus S gene (using the 493-708th amino acid fragment of strain S gene);

[0063] The nucleotide sequence of the fusion gene CTLA4-PEDVS-1 is shown in SEQ ID NO.7:

[0064] ATGGAAATGAAAGGGATGCACGTGGCCCAACCTGCAGTAGTGCTGGCCAACAGCCGGGGTGTTGCCAGCTTTGTGTGTGAGTATGGGTCTGCAGGCAAAGCTGCCGAGGTCCGGGTGACAGTGCTGCGGCGGGCCGGCAGCCAGATGACTGAAGTCTGTGCCGCGACATATACTGTGGAGGATGAGTTGACCTTCCTTGATGACTCTACATGCACTGGCACCTCCACCGAAAACAAAGTGA...

Embodiment 2

[0081] Example 2 Packaging recombinant adenovirus type 5 rAd-CTLA4-PEDVS, rAd-CTLA4-PEDVS-1 and rAd-PEDVS

[0082] During the process of packaging the recombinant virus, it was found that the full-length fragment of the S protein is difficult to export (probably because the fragment is too large), so the full-length fragment is not suitable for use as a recombinant adenovirus vector.

[0083] 2.1 Packaging recombinant adenovirus type 5

[0084] (1) Plant 1×10 in a 10cm petri dish 6 One HEK293 cell, cultivated until the cells cover 80-90% of the bottom of the dish;

[0085] (2) Use lipo2000 liposomes for transfection: Take 1 μg of pDC316-CTLA4-PEDVS, pDC316-CTLA4-PEDVS-1, pDC316-PEDVS plasmids and 3 μg of pBHGlox(delta)E13Cre plasmids and add them to 0.5 mL serum-free DMEM At the same time, add 10 μL lipo2000 to 0.5 mL serum-free DMEM medium and let stand at room temperature for 10 min;

[0086] (3) Add the solution of the plasmid in step (2) dropwise to the solution contain...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a porcine epidemic diarrhea virus fusion gene as well as an encoding protein and application thereof. According to the invention, a porcine CTLA4 gene and a porcine epidemic diarrhea virus S gene are selected to synthesize a fusion gene CTLA4-PEDVS; the recombinant adenovirus vector rAd-CTLA4-PEDVS is obtained by cloning the fusion gene to an adenovirus shuttle vector plasmid and co-transfecting cells with an adenovirus packaging plasmid, and the recombinant adenovirus vector rAd-CTLA4-PEDVS can be safely used after being purified and can stimulate stronger cellular and humoral immune response; the recombinant adenovirus 5 rAd-CTLA4-PEDVS has good safety and high immune titer, can be immunized once a half a year, is suitable for large-scale production, can effectively prevent and treat the porcine epidemic diarrhea virus, does not generate M protein and other proteins and antibodies of the epidemic diarrhea virus, and is easy to distinguish infected animals.

Description

technical field [0001] The invention belongs to the technical field of biotechnology, and in particular relates to a porcine epidemic diarrhea virus fusion gene, its encoded protein and its application. Background technique [0002] Porcine epidemic diarrhea (Porcine epidemic diarrhea, PED) is caused by Coronaviridae porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV) and is characterized by diarrhea, vomiting, dehydration and highly lethal piglets of all ages. Highly contagious enteric infectious disease. PED is widely prevalent in various regions of the world, and the economic loss has a great impact. The nucleotide length of S gene of epidemic diarrhea virus is different, and its nucleotide length is between 4143bp-4161bp. Over the years, there have been many studies on the molecular epidemiological data of the S gene of PEDV. Through research, it has been found that the S gene can be used as a basis for PEDV genotyping, which can be divided into two...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C07K19/00C12N15/861C12N5/10A61K39/215A61K39/39A61P31/14
CPCC07K14/165C07K14/70521C12N15/86A61K39/12A61K39/39A61P31/14C07K2319/00A61K2039/552C12N2770/20034A61K2039/55588Y02A50/30
Inventor 张大生
Owner 长沙爱科博生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap