Supercharge Your Innovation With Domain-Expert AI Agents!

Application of RNA Hsacirc0063865 inhibitor in preparation of esophageal squamous cell carcinoma resisting medicine

An inhibitor, esophageal squamous cell technology, applied in the field of biomedicine, can solve the problems of poor treatment effect and single drug treatment of esophageal squamous cell carcinoma, achieve good drug development prospects, reduce treatment costs, and inhibit proliferation

Active Publication Date: 2022-05-06
SOUTHEAST UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide the application of an RNA Hsa_circ_0063865 inhibitor in the preparation of anti-esophageal squamous cell carcinoma drugs, mainly to solve the problems of single drug treatment and poor therapeutic effect of esophageal squamous cell carcinoma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of RNA Hsacirc0063865 inhibitor in preparation of esophageal squamous cell carcinoma resisting medicine
  • Application of RNA Hsacirc0063865 inhibitor in preparation of esophageal squamous cell carcinoma resisting medicine
  • Application of RNA Hsacirc0063865 inhibitor in preparation of esophageal squamous cell carcinoma resisting medicine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: The expression level of Hsa_circ_0063865 in esophageal squamous cell carcinoma tissue was significantly higher than that in paracancerous tissue detected by RT-QPCR;

[0022] 1. RNA extraction from tissue samples of esophageal squamous cell carcinoma

[0023] 1) After the approval of the Medical Ethics Committee of Southeast University and the informed consent of the patients / family members, 96 patients diagnosed with esophageal squamous cell carcinoma in the First People's Hospital of Huai'an City, Jiangsu Province from 2009 to 2012 were selected, and a total of 96 cancer tissues were collected. and corresponding paracancerous tissues;

[0024] 2) Take 0.1cm 3 Cut the tissue into pieces with scissors, put it into a 1.5mL EP tube, add 1mL Trizol and 3 grinding steel balls, grind at 70Hz for 10min (the grinding box is pre-cooled in advance), and then follow the routine extraction steps of Trizol reagent;

[0025] 3) Take 1 μL of RNA sample to detect its conc...

Embodiment 2

[0042] Example 2 Hsa_circ_0063865 is involved in the malignant transformation of esophageal cancer induced by nitrosamine combined with algae toxin

[0043]1. Construction of Hsa_circ_0063865 low-expression cell model The two Hsa_circ_0063865 siRNA sequences constructed were siRNA1: AGCGGCUCAGGCAGCUGAGG (SEQ ID NO.4) and siRNA2: CCUCAGCUGCCUGAGCCGCU (SEQ ID NO.5), and the sequence selected by NC was NC1: UUCUCCGAACGUGUCACGU (SEQ ID NO. .6) and NC2: ACGUGACACGUUCGGAGAA (SEQ ID NO. 7). The Hsa_circ_0063865 siRNA sequence was used to construct the interference lentivirus. The interference plasmid is pHBLV-U6-Puro-RFP, and the U6 promoter universal primer GGACTATCATATGCTTACCG. Subsequent steps were followed by conventional lentiviral transfection steps. The RNA of the stably transfected cell line was extracted, and the interference efficiency of Hsa_circ_0063865 was detected by RT-QPCR.

[0044] 2. Hsa_circ_0063865 is involved in the malignant transformation of esophageal cance...

Embodiment 3

[0050] Example 3 Construction of Hsa_circ_0063865-specific siRNA to verify its impact on biological phenotype

[0051] 1) Construction of Hsa_circ_0063865 low-expression stable transfection cell model: use Hsa_circ_0063865 siRNA and interference control lentivirus to transfect Het-1A-T, and use purine screening to obtain Hsa_circ_0063865 Low , Si-NC cell line.

[0052] 2) Detection of cell proliferation ability: with 1×10 4 Cells were seeded in 96-well plates per well, and EdU was incubated for 2 hours when the cells grew to 50% confluence, and the following steps were followed by BeyoClick TM According to the instructions of the EdU cell proliferation detection kit; finally, wash twice with PBS, each time for 5 minutes; discard the washed PBS, add 50 μL of new PBS to each well, observe and take pictures under a microscope; randomly select 5 fields of view in each well to take pictures, and count the green cells (proliferating cells), number of blue cells (total cells).

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of an RNAHsacirc0063865 inhibitor in preparation of a medicine for resisting esophageal squamous cell carcinoma, which is characterized in that the expression level of circular RNA in esophageal squamous cell carcinoma tissue is obviously higher than that in para-carcinoma tissue, and the expression level of the circular RNA in esophageal squamous cell carcinoma cells is changed by constructing Hsacirc0063865 specific siRNAs and other molecular biology means. It is found for the first time that interference on Hsacirc0063865 expression can significantly inhibit proliferation, invasion and migration of esophageal squamous cell carcinoma cells, promote apoptosis of the carcinoma cells and other tumor cell biological phenotypes, so that the Hsacirc0063865 specific siRNAs constructed by the invention can be applied to preparation, screening or treatment of esophageal squamous cell carcinoma or inhibition of esophageal squamous cell carcinoma metastasis, and the application of the Hsacirc0063865 specific siRNAs in preparation, screening or treatment of esophageal squamous cell carcinoma is wide. And a novel treatment method is provided for intervention or treatment of esophageal squamous cell carcinoma.

Description

technical field [0001] The invention relates to the application of an RNA Hsa_circ_0063865 inhibitor in the preparation of anti-esophageal squamous cell carcinoma drugs, belonging to the technical field of biomedicine. Background technique [0002] Esophageal cancer is a digestive tract tumor characterized by high morbidity, high mortality and high recurrence rate. According to the 2020 global cancer statistics, the incidence of esophageal cancer ranks seventh in the world, and the death rate ranks sixth. It is one of the high-incidence malignant tumors that threaten human health worldwide. The pathological types of esophageal cancer mainly include squamous cell carcinoma and adenocarcinoma. In South Africa, East Africa, East Asia and other high-incidence areas of esophageal cancer, 90% of the pathological types are esophageal squamous cell carcinoma. my country is the country with the highest morbidity and mortality rate of esophageal cancer in the world. Due to factors su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61K31/713A61P35/00
CPCA61K45/00A61K31/713A61P35/00
Inventor 刘冉高志奎孙明军
Owner SOUTHEAST UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More