Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of GrpE protein or coding gene thereof as specific molecular target for resisting laodelphax striatellus and rice stripe virus

A technology of stripe virus and SBPH, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of crop disease, economic loss, disease accompanying insect pest, etc.

Active Publication Date: 2022-06-03
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Plant viruses cannot be treated at the level of a single plant. The symbiosis between viruses and vector insects often causes large-scale disease of crops, and diseases are accompanied by insect pests, causing greater economic losses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of GrpE protein or coding gene thereof as specific molecular target for resisting laodelphax striatellus and rice stripe virus
  • Application of GrpE protein or coding gene thereof as specific molecular target for resisting laodelphax striatellus and rice stripe virus
  • Application of GrpE protein or coding gene thereof as specific molecular target for resisting laodelphax striatellus and rice stripe virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1. Discovery of LsGrpE protein and its encoding gene

[0055] 1. Discovery of LsGrpE protein and its encoding gene

[0056] The inventors of the present invention discovered a new protein from S. striatellus, named LsGrpE protein, as shown in SEQ ID NO: 1 of the sequence listing. In Sequence 1, amino acid residues 1 to 45 constitute a mitochondrial transit peptide (mitochondriatransitpeptide, mTP).

[0057] The gene encoding the LsGrpE protein was named LsGrpE gene. In the cDNA of S. striatellus, the coding frame of the LsGrpE gene is shown in SEQ ID NO: 2 of the sequence listing.

[0058] 2. LsGrpE protein is a protein located in mitochondria

[0059]The cells of the larvae not carrying RSV were taken, and the whole worm protein, mitochondrial protein and cytoplasmic protein were separated and obtained, and then subjected to polyacrylamide gel electrophoresis, and then the anti-LsGrpE polyclonal antibody was used as the primary antibody for western blot dete...

Embodiment 2

[0060] Example 2. The decreased expression level of LsGrpE gene promotes the mortality of S. striatellus

[0061] 1. Preparation of dsRNA LsGrpE

[0062] 1. Take SBPH larvae, extract total RNA, and reverse-transcribe to obtain cDNA.

[0063] 2. Using the cDNA obtained in step 1 as a template, a primer pair composed of LsGrpE T7f and LsGrpE T7r is used for PCR amplification, and the PCR amplification product is recovered.

[0064] LsGrpE T7f: 5'- GGATCCTAATACGACTCACTATAGG ATGCTTCTGTTCTTCCAACCA-3';

[0065] LsGrpE T7r: 5'- GGATCCTAATACGACTCACTATAGG AGGCCTGATGATAGTTGGGAT-3'.

[0066] 3. Take the PCR amplification product obtained in step 2 and prepare dsRNA by in vitro transcription, which is dsRNA LsGrpE . dsRNA LsGrpE As shown in Sequence 3 of the Sequence Listing.

[0067] 2. Preparation of dsRNA GFP

[0068] DNA molecules are synthesized and then reverse transcribed to prepare dsRNA GFP . dsRNA GFP As shown in Sequence 4 of the Sequence Listing.

[0069] 3. M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a GrpE protein or an encoding gene thereof as a molecular target for specifically resisting laodelphax striatellus and rice stripe virus. The invention provides a protein, which is derived from Laodelphax striatellus, is named as LsGrpE protein, and is a protein shown as a sequence 1 in a sequence table. The gene for coding the LsGrpE protein is named as the LsGrpE gene and also belongs to the protection range of the invention. The invention also protects the application of the LsGrpE protein or the LsGrpE gene as a molecular target. The molecular target is an anti-laodelphax striatellus and / or anti-stripe virus molecular target. The LsGrpE can be used as an anti-laodelphax striatellus molecular target for preventing and treating laodelphax striatellus, and can indirectly prevent the vertical propagation process of RSV (Respiratory Syndrome Virus).

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of a GrpE protein or its encoding gene as a molecular target for specific resistance to S. striatellus and rice streak virus. Background technique [0002] The white planthopper (Laodelphax striatellus) is an important agricultural pest and a vector of many plant viruses. This insect mainly feeds on the sap of grasses, and the SBPH of different ages can suck the sap from the sieve tube of rice through the piercing-sucking mouthparts to maintain survival. Its high-density feeding will cause the loss of plant nutrients and the infection of feeding wounds by pathogenic microorganisms. Its transmission of viruses can cause outbreaks of plant virus diseases. Plant viruses cannot be treated at the level of individual plants. The mutualistic symbiosis of viruses and vector insects often causes diseases in large areas of crops, and diseases are accompanied by pests, causing g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12C12N15/113A01N57/16A01P1/00A01P7/04
CPCC07K14/43563C12N15/113A01N57/16C12N2310/14Y02A50/30
Inventor 张莉莉宋直钰霍岩
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More