Application of GrpE protein or coding gene thereof as specific molecular target for resisting laodelphax striatellus and rice stripe virus
A technology of stripe virus and SBPH, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of crop disease, economic loss, disease accompanying insect pest, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1. Discovery of LsGrpE protein and its encoding gene
[0055] 1. Discovery of LsGrpE protein and its encoding gene
[0056] The inventors of the present invention discovered a new protein from S. striatellus, named LsGrpE protein, as shown in SEQ ID NO: 1 of the sequence listing. In Sequence 1, amino acid residues 1 to 45 constitute a mitochondrial transit peptide (mitochondriatransitpeptide, mTP).
[0057] The gene encoding the LsGrpE protein was named LsGrpE gene. In the cDNA of S. striatellus, the coding frame of the LsGrpE gene is shown in SEQ ID NO: 2 of the sequence listing.
[0058] 2. LsGrpE protein is a protein located in mitochondria
[0059]The cells of the larvae not carrying RSV were taken, and the whole worm protein, mitochondrial protein and cytoplasmic protein were separated and obtained, and then subjected to polyacrylamide gel electrophoresis, and then the anti-LsGrpE polyclonal antibody was used as the primary antibody for western blot dete...
Embodiment 2
[0060] Example 2. The decreased expression level of LsGrpE gene promotes the mortality of S. striatellus
[0061] 1. Preparation of dsRNA LsGrpE
[0062] 1. Take SBPH larvae, extract total RNA, and reverse-transcribe to obtain cDNA.
[0063] 2. Using the cDNA obtained in step 1 as a template, a primer pair composed of LsGrpE T7f and LsGrpE T7r is used for PCR amplification, and the PCR amplification product is recovered.
[0064] LsGrpE T7f: 5'- GGATCCTAATACGACTCACTATAGG ATGCTTCTGTTCTTCCAACCA-3';
[0065] LsGrpE T7r: 5'- GGATCCTAATACGACTCACTATAGG AGGCCTGATGATAGTTGGGAT-3'.
[0066] 3. Take the PCR amplification product obtained in step 2 and prepare dsRNA by in vitro transcription, which is dsRNA LsGrpE . dsRNA LsGrpE As shown in Sequence 3 of the Sequence Listing.
[0067] 2. Preparation of dsRNA GFP
[0068] DNA molecules are synthesized and then reverse transcribed to prepare dsRNA GFP . dsRNA GFP As shown in Sequence 4 of the Sequence Listing.
[0069] 3. M...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
PatSnap Eureka turns technology decisions into work you can execute. Powered by our Innovation Knowledge Graph, it runs expert workflows across engineering, life sciences, materials and intellectual property. Get your review-ready output in minutes.
