Nucleic acid aptamer for detecting microglial cells and application of nucleic acid aptamer

A microglia and nucleic acid aptamer technology, applied in the field of molecular biology, can solve the problem of not binding to microglia, and achieve the effects of no cytotoxicity, small molecular weight, and no immunogenicity

Pending Publication Date: 2022-08-02
THE EYE HOSPITAL OF WENZHOU MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, to our knowledge, no microglia-specific aptamers have been reported, although aptamer A2 targeting human monocytes and macrophages has been reported (Sylvestre, M.; Saxby, C. P.; Kacherovsky, N.; Gustafson, H.; Salipante, S. J.; Pun, S. H. Identification of a DNA Aptamer That Binds to Human Monocytes and Macrophages. BioconjugChem 2020, 31 (8), 1899-1907), but it does not bind microglia cell

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer for detecting microglial cells and application of nucleic acid aptamer
  • Nucleic acid aptamer for detecting microglial cells and application of nucleic acid aptamer
  • Nucleic acid aptamer for detecting microglial cells and application of nucleic acid aptamer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Screening the nucleic acid aptamers by cell-SELEX technology.

[0040] (1) Design of nucleic acid library and primers used:

[0041] Random single-stranded DNA library:

[0042] 5'-ACCGACCGTGCTGGACTCA(N)42ACTATGAGCGAGCCTGGCG -3' (N represents four arbitrary bases of A, T, G, and C)

[0043] Upstream primer: 5'-Fluorescein isothiocyanate-ACCGACCGTGCTGGACTCA-3'

[0044] Downstream primer: 5'-Biotin-CGCCAGGCTCGCTCATAGT-3'

[0045] (2) Screening process:

[0046] In the present invention, mouse microglia BV2 is used as a positive screening target, and mouse neural stem cell C17.2 is used as a negative screening target.

[0047] 2.1 Positive screening:

[0048] a. Incubation: Dissolve the above random DNA library with binding buffer, denature at 95°C for 5 minutes, renature on ice for 10 minutes, and then mix with the pretreated mouse microglia BV2 cells that have been cultured for more than 24 hours and have a confluency of about 90%. Incubate for 1 h at 4°C...

Embodiment 2

[0055] Example 2 Binding of nucleic acid aptamer ZH-1 obtained by flow detection to mouse microglia BV2 and mouse neural stem cells C17.2

[0056] First, mouse microglia BV2 and mouse neural stem cells C17.2 were cultured for 24 hours to make the cell density reach 90%, and then the adherent cells were digested from the culture dish with 0.2% EDTA. 250 nM of synthesized FAM-labeled ZH-1c was prepared with 200 μl binding buffer, denatured at 95°C for 5 min, and renatured on ice for 10 min. Incubate with 300,000 BV2 cells or C17.2 cells for 1 h at 4°C. The incubated cells were washed 2-3 times with wash buffer and then resuspended in 300 μl of wash buffer. Fluorescence detection was performed by flow cytometry, and the DNA initial random library served as a control. The nucleic acid aptamer only binds the target cell BV2, not C17.2, the results are as follows figure 2 shown.

Embodiment 3

[0057] Example 3 The binding of the nucleic acid aptamer ZH-1 to mouse microglia BV2 after a series of deletions was detected by flow cytometry.

[0058] First, according to the secondary structure of ZH-1, the following sequence deletion optimization was performed on ZH-1:

[0059] The full-length sequence of ZH-1 is: ACCGACCGTGCTGGACTCATATGGTTAGTGTCAAAGAAATAGAAAGATTTACCGAGTTTTGACTATGAGCGAGCCTGGCG

[0060] ZH-1a: 4 bases are deleted in the 5'-end primer region, and 2 bases are deleted in the 3'-end primer region

[0061] ACCGTGCTGGACTCATATGGTTAGTGTCAAAGAAATAGAAAGATTTACCGAGTTTTGACTATGAGCGAGCCTGG

[0062] ZH-1b: 9 bases were deleted from the 5' primer region, and 7 bases were deleted from the 3' primer region

[0063] GCTGGACTCATATGGTTAGTGTCAAAGAAATAGAAAGATTTACCGAGTTTTGACTATGAGCGAG

[0064] ZH-1c: 16 bases are deleted at the 5' end, 12 bases are deleted at the 3' end, and the intermediate stem-loop structure is retained

[0065] TCATATGGTTAGTGTCAAAGAAATAGAAAGATTTACCGAGTTTTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

According to the nucleic acid aptamer for detecting the microglial cells and the application, the prepared nucleic acid aptamer has a unique stem-loop structure, and it is found through flow detection that the nucleic acid aptamer has high binding affinity and specificity, the microglial cells can be specifically recognized, and non-microglial cells are not recognized. The screened aptamer can be further truncated and optimized, has the advantages of small molecular weight, synthesis cost saving, affinity improvement, easy modification and transformation, no cytotoxicity, strong binding specificity, no immunogenicity and high stability, the molecular target of the aptamer for recognizing microglial cells is transmembrane protein CD64, the expression of the transmembrane protein CD64 is increased under the inflammatory stimulation of LPS and IFN-gamma, and the transmembrane protein CD64 can be used for identifying microglial cells. Therefore, the affinity of the aptamer and the microglial cells subjected to inflammatory activation is higher. Due to the advantages, the nucleic acid aptamer has important potential for diagnosis and targeted regulation of CD64 protein related diseases as a microglial cell specific recognition molecular probe.

Description

technical field [0001] The invention specifically relates to the technical field of molecular biology, in particular to a nucleic acid aptamer for detecting microglial cells and its application. Background technique [0002] Microglia are the resident tissue immune cells of the central nervous system (CNS). Neuroinflammation resulting from dyshomeostasis and dysfunction of microglia has been shown to be a key factor in the secondary injury of the traumatic central nervous system and the pathology of neurodegenerative diseases. Aiming at the important regulatory properties of microglia, the development of a molecular tool to identify and target microglia is undoubtedly of great value and significance for clinical diagnosis and treatment. [0003] In terms of identifying microglia, the traditional method is to use antibodies to screen microglia markers, and the positive expression of certain antigens indicates that the cells are microglia. This approach can distinguish micro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/115G01N33/68
CPCC12N15/115G01N33/6872G01N33/56966C12N2310/16C12N2310/531C12N2320/32G01N2800/28
Inventor吴文灿朱晖吴恩德潘昭琪张弛王亚楠廖倩玲
OwnerTHE EYE HOSPITAL OF WENZHOU MEDICAL UNIV