Yeast expression for secretory fusion protein

A fusion protein and secretion technology, which is applied in the field of bioengineering, can solve the problems that MX fusion protein cannot be induced and regulated, the gene of fusion protein is not integrated, and the gene of MX fusion protein is lost, etc.

Inactive Publication Date: 2004-05-05
上海兆安医学科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] (1) In the prior art, a DNA plasmid is used to transfer the MX fusion protein gene, but the introduced fusion protein gene is not integrated into the chromatin of yeast
Therefore, the gene for the MX fusion protein is easily lost during outgrowth expression
[0004] (2) The expression of MX fusion protein cannot be induced and regulated
At present, there is no report on the induced expression of MX fusion protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Cloning of GM-CSF and IL-3 CDNA by RT-PCR

[0029] Human normal liver cell line ATCC CCL13 was grown and cultured in DMEM medium containing 10% calf serum in a carbon dioxide cell incubator at 37°C and 5% CO 2 nourish. Harvest 1×10 8 CCL13 cells. RNA was extracted from harvested CCL13 cells with RNA extraction column produced by Qiagen. The obtained RNA serves as a template for reverse transcription (RT) reactions. The extracted RNA was reverse transcribed with random primers (Random Primer) and MMLV reverse transcriptase. The obtained product was used as a template for the next step of DNA polymerase chain reaction (PCR).

[0030] With the following two pairs of primers, MX-1 and MX-2, MX-3 and MX-4,

[0031] MX-1 :

[0032] 5'GCTCTA GAGGAGGATGTGGCTGCAGA 3' (SEQ ID NO: 3)

[0033] MX-2 :

[0034]5′GCG GATCCGCCGCCACCCCCAGATCCACCGCCACCCTCC

[0035] TGGACTGGCTCCCAG 3' (SEQ ID NO: 4)

[0036] MX-3 :

[0037] 5'CGGATCCGCTCCCATGACCCAGACAAC 3' (SEQ ID NO: 5...

Embodiment 2

[0042] Linking GM-CSF cDNA and IL-3 cDNA to form MX fusion gene

[0043] The PCR products of primers MX-1 and MX-2 (ie, the coding sequence of GM-CSF) were digested with endonucleases XbaI and BamHI. The PCR products of primers MX-3 and MX-4 (ie, the coding sequence of IL-3) were digested with endonuclease BamHI. The working plasmid pBluescript was digested with Xbal and BamHI.

[0044] The three products of each digestion were ligated at 16°C with T4 DNA ligase. The ligation product was transformed into Escherichia coli. Then, the DNA plasmid was extracted and analyzed by restriction enzymes, and it was determined that GM-CSF and IL-3 DNA connected as one was formed in it, called PMX fusion gene.

Embodiment 3

[0046] Cloning of MX Fusion Gene for Yeast Expression by PCR

[0047] Using the above-identified PMX fusion gene as a template, a PCR reaction was carried out with the following primers 1 and 2 to clone the MX fusion gene for yeast expression.

[0048] Primer 1:

[0049] 5'GCTCGAGAAAAGCACCCCGCCCGCTCGCCC 3' (SEQ ID NO: 7)

[0050] Primer 2:

[0051] 5'CGGATCCGAACGAGCTGGACGTTGGAC 3' (SEQ ID NO: 8)

[0052] The PCR product was digested with endonucleases Xho I and BamHI, then inserted into the working plasmid Bluescript digested with Xho I and BamHI, transformed into Escherichia coli, DNA plasmid was extracted, and analyzed by endonuclease digestion. The plasmid containing the correct fusion protein MX gene for yeast expression was named Bluescript.mx. Bluescript.mx was digested with Xho I and Not I, and then the resulting MX fusion gene was inserted into the yeast plasmid pPIC9 (Gene 105:205, 1991) (there are many specific yeast DNA sequences on this plasmid, including sec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a method for expressing the secretory granulocyte-macrophage colony stimulating factor (GM-CSF) and fusion protein of interleukin 3 (IL-3) in yeast, the engineering bacteria for preparing said fusion protein, and the resultant fusion protein MX. Said fusion protein MX gene is very stable and can be controlled to expression. Its resultant has natural amino acid protein sequence without replacement mutation.

Description

technical field [0001] The present invention relates to the field of bioengineering, more specifically to expressing in yeast the fusion protein of secreted granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin 3 (IL-3) (abbreviated as "MX fusion protein") Protein"), also relates to the engineering bacteria producing the fusion protein and the produced fusion protein MX. Background technique [0002] Granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-3 (IL-3) are two cytokines that play important roles in the human body. A fusion protein formed by fusing two cytokines together (abbreviated as "MX fusion protein") may have the advantages of both. At present, there is a technical method for expressing MX fusion protein with yeast, but this method has the following disadvantages: [0003] (1) In the prior art, a DNA plasmid is used to transfer the MX fusion protein gene, but the introduced fusion protein gene is not integrated into t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/24C12N15/27C12N15/62C12N15/64C12N15/81
Inventor楼觉人
Owner上海兆安医学科技有限公司