Application of nicotiana benthamiana ALKBH9B gene in regulation and control of plant virus resistance and transgenic plant cultivation method

A technology of transgenic plants and breeding methods, which is applied in the fields of botany equipment and methods, angiosperm/flowering plants, biochemical equipment and methods, etc., which can solve the problems of mining anti-virus genes and achieve the effect of disease reduction

Pending Publication Date: 2022-08-05
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These plants carrying recessive disease-resistant genes are excellent disease-resistant resources, but the work of mining anti-virus genes in nature is very long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of nicotiana benthamiana ALKBH9B gene in regulation and control of plant virus resistance and transgenic plant cultivation method
  • Application of nicotiana benthamiana ALKBH9B gene in regulation and control of plant virus resistance and transgenic plant cultivation method
  • Application of nicotiana benthamiana ALKBH9B gene in regulation and control of plant virus resistance and transgenic plant cultivation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0025] A method for cultivating ALKBH9B transgenic plants resistant to turnip mosaic virus: by leaf disc method, a gene knockout vector carrying the ALKBH9B gene target is introduced into a target plant to obtain a N. benthamiana ALKBH9B gene mutation homozygous plant.

[0026] Specifically include the following steps:

[0027] (1) According to the sequence alignment of the N. benthamiana gene database, it was found that there are two copies of the ALKBH9B gene;

[0028] (2) Perform CRISPR target screening on the public conserved regions of the two copies of ALKBH9B to obtain the gRNA target sequence: accaaactgcattgtgaca, as shown in SEQ ID NO: 2; design primers for PCR amplification, and clone to obtain the ALKBH9B-gRNA fragment; wherein , the primers are ALKBH9B-gRNA-F and ALKBH9B-gRNA-R, and the sequences are shown in SEQ ID NOs: 3-4 respectively;

[0029] ALKBH9B-gRNA-F:gtcgaagtagtgattgaccaaactgcattgtgacagttttagagctaga;

[0030] ALKBH9B-gRNA-R:ttctagctctaaaactgtcacaatgca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a nicotiana benthamiana ALKBH9B gene in regulation and control of plant virus resistance and a transgenic plant cultivation method, the virus is a potato Y virus virus turnip mosaic virus, and the transcript sequence of the ALKBH9B gene is shown as SEQ ID NO: 1. According to the invention, a gene knockout vector carrying a target gene target is introduced into a target plant through a tobacco leaf disc agrobacterium transformation method to obtain a nicotiana benthamiana ALKBH9B gene mutation homozygous plant, and the plant can significantly reduce the infection of turnip mosaic virus.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the application of Nicotiana benthamiana ALKBH9B gene in regulating plant resistance to virus and a method for cultivating transgenic plants. Background technique [0002] Turnip mosaic virus (TuMV) can infect at least 318 species of dicotyledons in 43 families, and is one of the most important plant viruses in agricultural production. TuMV is widely distributed in North America, Europe, South Africa, Asia, Australia and other parts of the world. Under natural conditions, TuMV mainly infects cruciferous crops and vegetables such as rape, cabbage, cabbage, and broccoli. Plants infected with TuMV will show severe symptoms, including verticillium, mosaic, mottled, and dwarfed. In my country, most of the cruciferous vegetables and rapeseed have TuMV damage, which can cause a 50% to 100% yield reduction in severe cases. TuMV not only has a wide range of hosts, but also ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C12N15/113C12N15/55C07K14/415A01H4/00A01H5/00A01H6/82
CPCC12N15/8283C12N15/8218C12N15/8205C12N15/113C12N9/22A01H4/005A01H4/008C12N2310/20Y02A50/30
Inventor李方方葛林豪周雪平
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI