Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection probe of phaeocystis

A technology for detecting probes and Phaeocystis sp. is applied in the field of specific probes and oligonucleotide probes, which can solve the problems of large fluctuation of detection results, difficult operation, and small number of capture probes, so as to facilitate the search. and realization, the effect of good probe applicability and high stability

Inactive Publication Date: 2006-10-04
SHANGHAI JIAOTONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its main disadvantages are: first, because the length of the capture probe is only 10-30 bp, the number of capture probes that can effectively distinguish close relatives of microalgae is very small; second, it is necessary to prevent RNA degradation during the entire detection process, However, various steps such as washing and antibody reaction can easily cause RNA degradation, so the operation is difficult and the test results fluctuate greatly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection probe of phaeocystis
  • Detection probe of phaeocystis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0030] Example: Application of S1 enzyme protection analysis for rRNA and sandwich hybridization technology for qualitative and quantitative detection of Phaeocystis

[0031] In this embodiment, the S1 enzyme protection analysis technology and the sandwich hybridization technology are combined to realize the qualitative and quantitative detection of the marine red tide organism Phaeocystis sp., the steps are as follows:

[0032] 1.1 The search for specific regions of Phaeocystis rRNA and the design and synthesis of probes for S1 enzyme protection analysis

[0033] By determining the 18S rRNA sequence of the Phaeocystis ribosomal small subunit and comparing it with the rRNA sequences of other algae, it is found that it is different from other algae in the 210-280 region of the small subunit rRNA, and the sequence of this region is determined as a characteristic sequence; The S1 enzyme protection analysis probe ZN_S1: 5'-CGATTCGAGCAGTTATTATGACTCAGCACACAACCGGGCGAACCCGAGAAGGTTTCTT (SE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A detecting probe of brown colpomenia for protecting and analyzing the S1 enzyme of said seaweed and detecting it by sandwich hybridization has mutually correlative three oligonucleotide probes including the S1 enzyme protecting and analyzing probe.

Description

Technical field [0001] The invention relates to a set of oligonucleotide probes for the detection of algae, in particular to specific probes for the qualitative and quantitative detection of Phaeocystis. It belongs to the field of nucleic acid detection. Background technique [0002] Phaeocystis sp. is a toxic algae that can produce toxins with hemolytic effect. It belongs to the Chrysophyta and Phaeocystis sp. It has caused red tides in the southern waters of my country many times. The algae spherical colony has a layer of soft gelatinous covering and the algae contains polysaccharides. When the algae multiply to form a red tide, the algae containing gelatin and sugars will cling to the gills, affecting the respiration and feeding of the fish. It causes fish to suffocate and die due to lack of oxygen; secondly, the huge biomass of the algae (especially at dawn and evening) can cause water shortages and cause disasters. In addition, the death and decay of algae and algae cells wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 李荣秀于志刚蔡青松米铁柱甄毓
Owner SHANGHAI JIAOTONG UNIV