Detection probe of phaeocystis
A technology for detecting probes and Phaeocystis sp. is applied in the field of specific probes and oligonucleotide probes, which can solve the problems of large fluctuation of detection results, difficult operation, and small number of capture probes, so as to facilitate the search. and realization, the effect of good probe applicability and high stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0030] Example: Application of S1 enzyme protection analysis for rRNA and sandwich hybridization technology for qualitative and quantitative detection of Phaeocystis
[0031] In this embodiment, the S1 enzyme protection analysis technology and the sandwich hybridization technology are combined to realize the qualitative and quantitative detection of the marine red tide organism Phaeocystis sp., the steps are as follows:
[0032] 1.1 The search for specific regions of Phaeocystis rRNA and the design and synthesis of probes for S1 enzyme protection analysis
[0033] By determining the 18S rRNA sequence of the Phaeocystis ribosomal small subunit and comparing it with the rRNA sequences of other algae, it is found that it is different from other algae in the 210-280 region of the small subunit rRNA, and the sequence of this region is determined as a characteristic sequence; The S1 enzyme protection analysis probe ZN_S1: 5'-CGATTCGAGCAGTTATTATGACTCAGCACACAACCGGGCGAACCCGAGAAGGTTTCTT (SE...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com