Human DNA polymerase beta mutant gene and its corresponding protein
A technology of polymerase and DNA molecules, applied in recombinant DNA technology, DNA/RNA fragments, genetic engineering, etc., can solve problems such as poor stability and loss of activity, and achieve the effect of improving postoperative survival rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: Cloning of M-POLB gene As shown in Figures 1, 2, 3, and 4, the acquisition approach of the M-POLB gene of the present invention and the M-POLB gene nucleotide sequence reading frame analysis are as follows 1. Tissue separation Surgical specimens of esophageal cancer tissue from invasive cancer in Linzhou City, Henan Province, a high-incidence area of esophageal cancer in China, were collected at the surgical site and stored in -196°C liquid nitrogen immediately. 2. Isolation of mRNA was selected with QIAGEN Total RNA Extraction Kit (according to the extraction kit) 3. Reverse transcription to synthesize cDNA fragments
[0039] 5×RT buffer (containing 50mmol / LMgCl 2 ) 6μl, 10mmol / L 4×dNTP 2μl, RNasin 40U, AMV 2U, downstream primer (P25'TCATTCGCTCCGGTCCTTGG 3') 1μl, extracted total RNA 5μl, DEPC water to make up 30μl, topped with 2 drops of liquid paraffin, reverse transcription in 42℃ water bath 45min. 4. PCR amplification and cloning
[0040] Amplificati...
Embodiment 2
[0052] 310 320 330 340 350 M13140 301 LGVTGVAGEP LPVDSEKDIF DYIQWKYREP KDRSE..... 350 M-POLB 301 ---------- --------- ---------- -----............... 350 Example 2: Gene detection method for M-POLB gene feature points
[0053] Design probes to detect the deletion of the characteristic point 177-234 of the M-POLB gene. The designed probes are used to detect the M-POLB gene of the present invention. Design probes may contain some or all of the following nucleotide sequences or complementary sequences:
[0054] 5'CTCGCAAACTTTGAGAAGAACGTGAGCCAAGCTATCCACAAGTACAATGCTTACAGAA 3'
[0055] See molecular cloning for specific nucleic acid molecular hybridization methods. If the hybridization reaction is positive, it can be diagnosed as esophageal cancer at an early stage.
[0056] PCR amplification to detect the missing primers at positions 177-234 of the M-POLB gene feature point, such as: upstream primer 5′GTCCTGGTACCTCCTTCAA 3′ downstream primer 5′ACTCGTATCATCCTGC...
Embodiment 3
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com